View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15156_high_3 (Length: 454)
Name: NF15156_high_3
Description: NF15156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15156_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 1e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 274 - 444
Target Start/End: Original strand, 23386761 - 23386931
Alignment:
| Q |
274 |
tgttgcttcttcttgtctcgcttctctaatgtgcccttatgtcaattttatagatttcatcttctttcgttcctatacgagcttatgcatatatgctata |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
23386761 |
tgttgcttcttcttgtctcgcttctctaatgtgcccttatgtcaattttatagatttcatcttctttcattcctatacgagcttatgcacatatgctata |
23386860 |
T |
 |
| Q |
374 |
agctgtatattcattattaaaccacatagctatgtccctgagattcacatcaattagggctttaactgatg |
444 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
23386861 |
agttgtatattcattattaaaccacatagctatgtccctgagattcacatcgattagggctttaacagatg |
23386931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University