View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15156_low_12 (Length: 263)
Name: NF15156_low_12
Description: NF15156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15156_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 11241651 - 11241413
Alignment:
| Q |
9 |
atcacagagtttacttggatttacagaactttcactgtgaatcgttttgtatccaattacttgcaatgattattgtaatttataaccgttggcaatttca |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11241651 |
atcacagagtttacttggatttatagaactttcactgtgaatcgttttgtatccaattacttgcaatgattattgtaatttataaccgttggcaatttca |
11241552 |
T |
 |
| Q |
109 |
gtcctcttatgtcatgtttaaatgtcatgattttttgtctctcatctaagaaaatgttatgattctgtcatgttttaaatttcatgacagttatacaaag |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11241551 |
gttctcttatgtcatgtttaaatgtcatgattttttgtctttcatctaagaaaatgttatgattctatcatgttttaaatttcatgacagttatacaaag |
11241452 |
T |
 |
| Q |
209 |
tttcaacatgggaagattcacacttaattatggaaatgg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11241451 |
tttcaacatgggaagattcacacttaattatgaaaatgg |
11241413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University