View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15156_low_14 (Length: 245)
Name: NF15156_low_14
Description: NF15156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15156_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 52 - 132
Target Start/End: Complemental strand, 14460298 - 14460218
Alignment:
| Q |
52 |
ctcagagaaacatgaccattgaaattcctcgatttgtagtaaattcatagacttctgatcgcggttcctcatgtttcattt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14460298 |
ctcagagaaacatgaccattgaaattcctcgatttgtagtaaattcatagacttctgatcgcggttcctcatgtttcattt |
14460218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 180 - 244
Target Start/End: Complemental strand, 14460193 - 14460129
Alignment:
| Q |
180 |
actagaactgatttgattaattgattaagtttgggttatggttttcccttgtccaagaattatct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14460193 |
actagaactgatttgattaattgattaagtttgggttatggttttcccttgtccaagaattatct |
14460129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University