View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15157_low_11 (Length: 334)
Name: NF15157_low_11
Description: NF15157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15157_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 43082026 - 43082342
Alignment:
| Q |
1 |
ttaatatactgagaagggctagtgcagacagtagcattaggtgtaccacaagtttcaaacacagtgaagttgtaaggaggttctcctgatccacagcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082026 |
ttaatatactgagaagggctagtgcagacagtagcattaggtgtaccacaagtttcaaacacagtgaagttgtaaggaggttctcctgatccacagcaga |
43082125 |
T |
 |
| Q |
101 |
cactgaacacatctttgaatccatacttgcttggattcttcatcacagtacggtaggcattgaagtaatcagcataaactatgactgcatgtggatactg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082126 |
cactgaacaaatctttgaatccatacttgcttggattcttcatcacagtacggtaggcattgaagtaatcagcataaactatgactgcatgtggatactg |
43082225 |
T |
 |
| Q |
201 |
tttcctgaattcttgtaatctagcttgcagcataaggttgtgattgttgcttaggtcattagcacttttcacacaccctaagtcgtctctgtcatcttca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082226 |
tttcctgaattcttgtaatctagcttgcagcataaggttgtgattgttgcttaggtcattagcacttttcacacaccctaagtcgtctctgtcatcttca |
43082325 |
T |
 |
| Q |
301 |
ggagctaaatacattgt |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43082326 |
ggagctaaatacattgt |
43082342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University