View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15157_low_15 (Length: 280)
Name: NF15157_low_15
Description: NF15157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15157_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 262
Target Start/End: Complemental strand, 33966695 - 33966435
Alignment:
| Q |
12 |
aagaatatgaatgaagtgaaagaactaagaaggggtttagtagcaacatccacacgtgtggtagacacgttcgaattaaatgtcgtaatgctgcagaaag |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966695 |
aagaaaatgaatgaagtgaaagaactaagaaggggtttagtagcaacatccacacgtgtggtagacacgttcgaattaaatgtcgtaatgctgcagaaag |
33966596 |
T |
 |
| Q |
112 |
aaatcgataaggaagatatttatgaagccgaactgaaccaaaaccaatccactgaatgaacaaaatctccatttcccgctatcaactatctagttccact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966595 |
aaatcgataaggaagatatttatgaagccgaactcaaccaaaaccaatccactgaatgaacaaaatctccatttcccgctatcaactatctagttccact |
33966496 |
T |
 |
| Q |
212 |
taagcatagc----------atagttagggttttctcttttcttacaaaaatggctactct |
262 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966495 |
taagcatagcatagcatagcatagttagggttttctcttttcttacaaaaatggctactct |
33966435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University