View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15157_low_27 (Length: 226)
Name: NF15157_low_27
Description: NF15157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15157_low_27 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 139602 - 139393
Alignment:
| Q |
1 |
ataactatatttataaaagagtgaaaatatttgttagaataacaaatatgactctaaagaaagcagataaataaatttaccagaacacaatgattgatta |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
139602 |
ataactatatttatcaaagagtgaaaatatttgttagaataacaaatatgactctgaagaaagcagataaataaatgtaccagaacacagtgattgatta |
139503 |
T |
 |
| Q |
101 |
ccaagttcgaccaattgtacttacgtttcaacaaagtagctattgtagttctcttttaaataatattgaggtttaaagtacacatttttgtttaaatacg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
139502 |
ccaagttcgatcaattgtacttacgtttcaacaaagtagctattatagttttcttttaaataatattgaggtttaaagtacacatttttgtttaaatact |
139403 |
T |
 |
| Q |
201 |
acagtccaga |
210 |
Q |
| |
|
|| ||||||| |
|
|
| T |
139402 |
acggtccaga |
139393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University