View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15157_low_28 (Length: 225)
Name: NF15157_low_28
Description: NF15157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15157_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 28521754 - 28521539
Alignment:
| Q |
1 |
ttcattgttaattcttttgctcataggtttggcttcataaagattgtaaacaagttagtcatgtcaaattgtgaattttttagtttatgacatgaataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
28521754 |
ttcattgttaattcttttgctcataggtttggcttcataaagattgtaaacaagttagtcatgtcaaattgtga--------gtttatgacatgaacaat |
28521663 |
T |
|
| Q |
101 |
tcaactaacacaagtgtaaataagctttggatcaatttgtacaagattnnnnnnngtgatatttagttatttagcaacaataatctcaccagtggtgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28521662 |
tcaactaacacaagtgtaaataagctttggatcaatttgtacaagattaaaaaaagtaatatttagttatttagcaacaataatctcaccagtggtgata |
28521563 |
T |
|
| Q |
201 |
attgcagatctgattgcagcagga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
28521562 |
attgcagatctgattgcagcagga |
28521539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University