View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15157_low_5 (Length: 492)
Name: NF15157_low_5
Description: NF15157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15157_low_5 |
 | |
|
| [»] scaffold0009 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 6 - 234
Target Start/End: Complemental strand, 42685 - 42459
Alignment:
| Q |
6 |
gtagattatacttatattttttgtacattaagatatcaaattttaccctttagcaatgtattacataactaattgcaaccataaataatgttttaatgca |
105 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42685 |
gtagattgtacttatattttttgtacatcaagatatccaatttcaccaattagcaatgtattacataactaattgcaaccataaataatgtattaatgca |
42586 |
T |
|
| Q |
106 |
gatttttagagtagtttattaaattctcctatgtgatgatcttaacagtatacatttattaaaataattaagggctttgcagaacgttatgaaggtgttg |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
42585 |
gatttcaagagtagtttattaaattctcctatgtgatgatcttaacagtatacatttattaaaataattaaggactttgc--aacgttatgaaggtgttg |
42488 |
T |
|
| Q |
206 |
cacactcctctctccggtttatcagattt |
234 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
42487 |
cacactcctctctccggtttatcggattt |
42459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 332 - 441
Target Start/End: Complemental strand, 41232 - 41127
Alignment:
| Q |
332 |
acttgattgtatacatttaaccagtaaatatttcatgaaaccttcatcttattatagtacgccgtgattgtactcatcgaacagtggccggtaactcgag |
431 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| | || ||||||| ||| |
|
|
| T |
41232 |
acttgattgtatacatttaactagtaaatatttcatgaaaccttcatcttattataatacgccgtgattgtattcatcgatcggt----ggtaacttgag |
41137 |
T |
|
| Q |
432 |
gaattatttt |
441 |
Q |
| |
|
|||||||||| |
|
|
| T |
41136 |
gaattatttt |
41127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University