View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1515_low_9 (Length: 312)
Name: NF1515_low_9
Description: NF1515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1515_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 282
Target Start/End: Original strand, 5012122 - 5012387
Alignment:
| Q |
17 |
aaaaacctgcaccgattaagcctcagtttgagagtaaatcacccatctttgaaaaagttatcctcaaaaaggtagatcacaaagaaataccagttcgtta |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012122 |
aaaaacctgcaccgattaagactcagtttgagagtaaatcacccatctttgaaaaagttatcctcaaaaaggtagatcacaaagaaataccagttcgtta |
5012221 |
T |
|
| Q |
117 |
tgttagatatattgggaatactgctggaacaccttctcaataccccgcgaggcatgtgttagatgcaacacatcaacaaggagggaacgtaactcctgga |
216 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012222 |
tgctagatatattgggaatactgctggaacaccttctcaataccccgcgaggcatgtgttagatgcaacacatcaacaaggagggaacgtaactcctgga |
5012321 |
T |
|
| Q |
217 |
agtaattttgcagatgaaaaggatccttccgaagaggaggaaaatggtaccttaggatcaactgaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5012322 |
agtaattttgcagatgaaaaggatccttccgaagaggaggaaaatggtaccttaggatcaattgaa |
5012387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University