View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15160_high_12 (Length: 252)
Name: NF15160_high_12
Description: NF15160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15160_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 29791079 - 29790952
Alignment:
| Q |
7 |
ggattgtgtcctgaaaatgttcttggtgaaggtggttatggaattgtttaccatggtgttcttacggatggtactaaagttgctgtcaaaaatctcttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29791079 |
ggattgtgtcctgaaaatgttcttggtgaaggtggttatggaattgtttaccatggtgttcttacggatggtactaaagttgctgtcaaaaatctcttga |
29790980 |
T |
|
| Q |
107 |
ataacaagtatgtgtttttttaaattct |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29790979 |
ataacaagtatgtgtttttttaaattct |
29790952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 7356947 - 7356715
Alignment:
| Q |
8 |
gattgtgtcctgaaaatgttcttggtgaaggtggttatggaattgtttaccatggtgttcttacggatggtactaaagttgctgtcaaaaatctcttgaa |
107 |
Q |
| |
|
|||| |||||| ||||| ||| ||||||||||| ||||||||||| ||| |||||||||||| || | ||||||||||||||||||||| |||||||| |
|
|
| T |
7356947 |
gattatgtcctaaaaatattcatggtgaaggtgattatggaattgcttattatggtgttcttattgaagatactaaagttgctgtcaaaaacctcttgaa |
7356848 |
T |
|
| Q |
108 |
taacaagtatgtgtttttttaaattctattt--gnnnnnnnnagttgaatttgatatgattttggtgtttactagttaatttgactctatc-cgttttct |
204 |
Q |
| |
|
||||||||||||||||||| ||||| | ||| ||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
7356847 |
taacaagtatgtgttttttcaaattatgttttatttttgtgtagttgaatttgatatgaatttggtgttgactagttaatttgactctatcttgttttct |
7356748 |
T |
|
| Q |
205 |
atgtatagtttgtgttgaaagtttgagttttgc |
237 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||| |
|
|
| T |
7356747 |
atgtaaagtttgtgttcaaagtttgcgttttgc |
7356715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 191 - 245
Target Start/End: Complemental strand, 29790929 - 29790875
Alignment:
| Q |
191 |
tctatccgttttctatgtatagtttgtgttgaaagtttgagttttgcctatgctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29790929 |
tctatccgttttctatgtatagtttgtgttgaaagtttgagttttgcttatgctt |
29790875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 22 - 119
Target Start/End: Original strand, 11035856 - 11035953
Alignment:
| Q |
22 |
aatgttcttggtgaaggtggttatggaattgtttaccatggtgttcttacggatggtactaaagttgctgtcaaaaatctcttgaataacaagtatgt |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| |||||||| || ||||||| || ||||| ||||||||||||||||| |
|
|
| T |
11035856 |
aatgttattggtgaaggtggttatggaattgtttatagtggtgttcttgttgatggtaccaagattgctgttaagaatcttttgaataacaagtatgt |
11035953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 63
Target Start/End: Original strand, 6208902 - 6208949
Alignment:
| Q |
16 |
cctgaaaatgttcttggtgaaggtggttatggaattgtttaccatggt |
63 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
6208902 |
cctgataatgttattggtgaaggtggttatggaattgtttatcatggt |
6208949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University