View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15160_high_15 (Length: 237)
Name: NF15160_high_15
Description: NF15160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15160_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 54864332 - 54864532
Alignment:
| Q |
18 |
agtacagaacatacatagaagattttgtgtactgaaaaacttaatgtggttaattatcccaacttgcttaactattttggtggttatttcttgatcaaaa |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54864332 |
agtacagaacatacataga---ttttgtgtactgaaaaacttaatgtggttaattatcccaacttgcttaactattttggtggttatttcttgatcaaaa |
54864428 |
T |
|
| Q |
118 |
ctacttgaatttctttgattagaagggtcttttcaaaatcaagactttaatttgggatattttccaagggaatattttacgagaagaagattagaggtac |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54864429 |
ctacttgaaattctttgattagaagggtcttttcataatcaagactttaatttgggatattttccaagggaatattttacgagaagaagattagaggtac |
54864528 |
T |
|
| Q |
218 |
tatt |
221 |
Q |
| |
|
|||| |
|
|
| T |
54864529 |
tatt |
54864532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University