View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15160_low_12 (Length: 269)

Name: NF15160_low_12
Description: NF15160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15160_low_12
NF15160_low_12
[»] chr4 (1 HSPs)
chr4 (37-252)||(47112734-47112949)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 37 - 252
Target Start/End: Complemental strand, 47112949 - 47112734
Alignment:
37 tataaaaactaatgacaaataattttttatcaatagacctaaaactatgattttagtaaccttactcttgaaccgatctgacacttttggagagagcttg 136  Q
    |||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||    
47112949 tataaaaattaatgacaaataattttttatcagtagacctaaaacaatgattttagtaaccttactctcgaaccgatctgacacttttggagagagcttg 47112850  T
137 tcaactcttatgccctaaggctttattgctggcaagaacgaatatgagcttcgagcattggagctgctatatatcaaatgcagatttgaagacttgattt 236  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
47112849 tcaactcttatggcctaaggctttattgctggcaagaacgaatatgagcttcgagaattggagctgctatatatcaaatgcagatttgaagacttgattt 47112750  T
237 aaaatttgttactatg 252  Q
    ||||||||||||||||    
47112749 aaaatttgttactatg 47112734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University