View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15160_low_13 (Length: 265)
Name: NF15160_low_13
Description: NF15160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15160_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 28669199 - 28669416
Alignment:
| Q |
1 |
gacacgtttgatgataatctaacggccatgacatgatcttaggacagacaatgcaaccgttgggattgaatggtatgatctttgaatagtcagaaatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28669199 |
gacacgtttgatgataatctaacggccataacatgatcttaggacagacaatgcaaccgttgggattgaatggtatgatctttgaatagtcagaaatttt |
28669298 |
T |
|
| Q |
101 |
ctaactttatttttatttttatggattaacatgtccttatcaacacctccctcaaaaaatgtctttatcaacacttactaaaccttttcattaacttaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28669299 |
ataactttatttttatttttatggattaacatgtccttatcaacacctccctcaaaaaatgtctttatcaacagttactaaaccttttcattaacttaat |
28669398 |
T |
|
| Q |
201 |
cacaactacacaattcct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28669399 |
cacaactacacaattcct |
28669416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University