View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15161_low_13 (Length: 267)
Name: NF15161_low_13
Description: NF15161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15161_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 43099797 - 43100000
Alignment:
| Q |
17 |
gagatgaagccgcagaggaaggatcttacaacagccgggggttcttcttcatatgtgaaggtggttgctggtgcttgatagaatgtggtggggtatgaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099797 |
gagatgaagccgcagaggaaggatcttacaacagccgggggttcttcttcatatgtgaaggtggttgctggtgcttgatagaatgtggtggggtatgaag |
43099896 |
T |
|
| Q |
117 |
atggtggtggtggaggaggagatgaataggggtaggaagcgccgccggagtagctgcccgggggtggattctgtggaggtggataggaggtgttgttctt |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099897 |
atggaggtggtggaggaggagatgaataggggtaggaagcgccgccggagtagctgcccgggggtggattctgtggaggtggataggaggtgttgttctt |
43099996 |
T |
|
| Q |
217 |
tttg |
220 |
Q |
| |
|
|||| |
|
|
| T |
43099997 |
tttg |
43100000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University