View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15161_low_17 (Length: 244)
Name: NF15161_low_17
Description: NF15161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15161_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 48173389 - 48173161
Alignment:
| Q |
1 |
atttccacgttgatgacgagaaataggaagagaaaggaatgaagttagaggggaagtggtttgttttggcaaaggagatgaaagtggaagcaatggtctg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48173389 |
atttccacgttgatgatgagaaataggaagagaaaggaatgaagttagaggggaagtggtttgttttggcaaaggagatgaaagtggaagcaatggtctg |
48173290 |
T |
 |
| Q |
101 |
aatctaatggtagt------agccattaatttgtttctacacttttcagctgccagaagcggttaatacagtttcattgctttatctatctacgaatgtc |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48173289 |
aatctaatggtagtgctagtagccattaatttgtttctacacttttcagctgccagaagcggttaatacagtttcattgctttatctatctacgaatgtc |
48173190 |
T |
 |
| Q |
195 |
tcacgccttatgttatctatctatctacg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48173189 |
tcacgccttatgttatctatctatctacg |
48173161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University