View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15161_low_9 (Length: 289)
Name: NF15161_low_9
Description: NF15161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15161_low_9 |
 |  |
|
| [»] scaffold0405 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 11 - 195
Target Start/End: Complemental strand, 30439814 - 30439630
Alignment:
| Q |
11 |
gagaagaatgcttcagaggaagaaggatctgataagtcttagtcggaatttgatgtcttagactaagaagaatgcttccgagttgaagaaaattatggct |
110 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30439814 |
gagaataatgcttcagaggaagaaggatttgataagtcttagtcggaatttgatgtcttagactaagaagaatgcttcagagttgaagaaaattatggct |
30439715 |
T |
 |
| Q |
111 |
aatgagaaagttgctgagattgttatggctgatccgaggcgggccaagaggtgttgtaattgaattactcaacgttttagttagt |
195 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
30439714 |
aatgagaaagctgctgagattgttatggctgatccgaggcgggccaagaggtgttgtaattgaatcattcaacgttttagttagt |
30439630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 9695742 - 9695780
Alignment:
| Q |
10 |
tgagaagaatgcttcagaggaagaaggatctgataagtc |
48 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9695742 |
tgagaagaatgcttcggaggaagaaggatctgagaagtc |
9695780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 14748 - 14563
Alignment:
| Q |
10 |
tgagaagaatgcttcagaggaagaaggatctgataagtcttagtcggaatttgatgtcttagactaagaagaatgcttccgagttgaagaaaattatggc |
109 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
14748 |
tgagaagaatgcttcggaagaagaaggatctcataagtctaagtctgaatttgatgtcttagactgagaagaatgcttcggagttgaagaaaattatggc |
14649 |
T |
 |
| Q |
110 |
taatgagaaagttgctgagattgttatggctgatccgaggcgggccaagaggtgttgtaattgaattactcaacgttttagttagt |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||| | |||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
14648 |
taatgagaaagttgttgagattgttatggctgatccgaagcggactaagaggtggtgtaattgaattattcaacgttttagttagt |
14563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 90 - 191
Target Start/End: Original strand, 27349715 - 27349816
Alignment:
| Q |
90 |
gagttgaagaaaattatggctaatgagaaagttgctgagattgttatggctgatccgaggcgggccaagaggtgttgtaattgaattactcaacgtttta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
27349715 |
gagttgaagaaaattatggctaatgagaaacttgctgagattgctatggctgatccgaagcgggctaagaggtgctgtaattgaattattcaacgtttta |
27349814 |
T |
 |
| Q |
190 |
gt |
191 |
Q |
| |
|
|| |
|
|
| T |
27349815 |
gt |
27349816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University