View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15162_low_8 (Length: 283)
Name: NF15162_low_8
Description: NF15162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15162_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 31 - 267
Target Start/End: Original strand, 34690375 - 34690611
Alignment:
| Q |
31 |
gttgggcataaatattcacatcaataacgatttagaggggggaatgctgatattccaaacccatttagccctaaaatagtttgtttcctgaaggcctgaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34690375 |
gttgggcataaatattcacatcaataacgatttagaggggggaatgctgatattccaaacccatttagccctaaaaaagtttgtttcctgaaggcctgaa |
34690474 |
T |
 |
| Q |
131 |
atgagcataagcagttttgagaaattgatgcttgccccgtttccaattaaccaagaagatttttctttgatttcattatactgattttttatactactcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34690475 |
atgagcataagcagttttgagaaattgatgcttgccccgtttccaattaaccaagaagatttttctttgatttcattatactgattttttatactactcc |
34690574 |
T |
 |
| Q |
231 |
atattgaagaaaaaatgtggtatgcaatgattctttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34690575 |
atattgaagaaaaaatgtggtatgcaatgattctttg |
34690611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 250
Target Start/End: Complemental strand, 29257870 - 29257837
Alignment:
| Q |
217 |
ttttatactactccatattgaagaaaaaatgtgg |
250 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
29257870 |
ttttatactgctccatattgaagaaaaaatgtgg |
29257837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University