View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_103 (Length: 262)
Name: NF15163_high_103
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_103 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 156 - 245
Target Start/End: Original strand, 45674847 - 45674936
Alignment:
| Q |
156 |
ttacagcacacacctgtggtcagaagtgaggacaagtttcttctgaccaaataattcacgttggaaatgtcggcatctctttctttcttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45674847 |
ttacagcacacacctgtggtcagaagtgaggacaagtttcttctgaccaaataattcacgttggaaatgtcggcatctctttctttcttt |
45674936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 13 - 118
Target Start/End: Original strand, 45674707 - 45674812
Alignment:
| Q |
13 |
aaaataatgatgaaatgaaagaagcttaatttagccaatcataatgtaacataatgctgataannnnnnngattgtatcagacacatttacaatatcaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45674707 |
aaaataatgatgaaatgaaagaagcttaatttagccaatcataatgtaacataatgctgataatttttttgattgtatcagacacatttacaatatcaat |
45674806 |
T |
|
| Q |
113 |
agaaaa |
118 |
Q |
| |
|
|||||| |
|
|
| T |
45674807 |
agaaaa |
45674812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University