View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_117 (Length: 247)
Name: NF15163_high_117
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_117 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 14756787 - 14757003
Alignment:
| Q |
15 |
atcaattatacatgtttttgtgggttgttcaggacaaaaatgcgtttatgttcactctggctactcagttgaaacttggcacatggcttagctggttatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14756787 |
atcaattatacatgtttttgtgggttgttcaggacaaaaatgcgtttatgttcactctggctactcagttgaaacttggcacatggcttagctggttatg |
14756886 |
T |
 |
| Q |
115 |
tcatcaatccctcaaagactttgattatgttcaaacttcaaactgttccaacgtgtcattttgaaatacttttttattaggaatgnnnnnnnnnatttac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14756887 |
tcatcaatccctcaaagactttgattatgttcaaacttcaaactgttccaacgtgtcattttgaaatacttttttattaggaatgttttttttaatttac |
14756986 |
T |
 |
| Q |
215 |
acaaactcaatagaatt |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14756987 |
acaaactcaatagaatt |
14757003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University