View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_118 (Length: 247)
Name: NF15163_high_118
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_118 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 233
Target Start/End: Original strand, 3946923 - 3946954
Alignment:
| Q |
202 |
gctctttttggatcaacctcagaagaggtaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3946923 |
gctctttttggatcaacctcagaagaggtaaa |
3946954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University