View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_38 (Length: 431)
Name: NF15163_high_38
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 20 - 409
Target Start/End: Complemental strand, 43408484 - 43408095
Alignment:
| Q |
20 |
cctctctcaaaaactggaagtgctagaagagatccatattgctgttgctgctgatgacgcggatagtcatggcttctaaagaaacgaacatgaacgttca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408484 |
cctctctcaaaaactggaagtgctagaagagatccatattgctgttgctgctgatgacgcggatagtcatggcttctaaagaaacgaacatgaacgttca |
43408385 |
T |
 |
| Q |
120 |
tgtttggattcacagaaacaggtgcagatgatgactcctgctgaaggtagtggttttgagtgtgaattagggctgatctcctcctcataggtacccatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408384 |
tgtttggattcacagaaacaggtgcagatgatgactcctgctgaaggtagtggttttgagtgtgaattagggctgatctcctcctcataggtacccatat |
43408285 |
T |
 |
| Q |
220 |
ctgaataaggacgttgttggatgagttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacagatgttgttggacctggattt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408284 |
ctgaataaggacgttgttggatgagttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacagatgttgttggacctggattt |
43408185 |
T |
 |
| Q |
320 |
gccctaggcccaatccaccatctcttcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtgcattccatt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408184 |
gccctaggcccaatccaccatctcttcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtgcattccatt |
43408095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University