View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_58 (Length: 347)
Name: NF15163_high_58
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 338
Target Start/End: Complemental strand, 40188049 - 40187729
Alignment:
| Q |
18 |
agaaagaccttcacttttgctttattctacgctcctttcattcccnnnnnnnngcttttgtgttaagagtgtgttctcacttatcacactcttttgtatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40188049 |
agaaagaccttcacttttgctttattctacgctcctttcattcccttttttttgcttttgtgttaagagtgtgttctcacttatcacactcttttgtatg |
40187950 |
T |
|
| Q |
118 |
ataataaataattgaaaaccctattggaaaatagttgttgtcatccnnnnnnngacctgtgtgtttcaccaaaaaatggagaaggcagagaccacattct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187949 |
ataataaataattgaaaaccctattggaaaatagttgttgtcatccaaaaaaagacctgtgtgtttcaccaaaaaatggagaaggcagagaccacattct |
40187850 |
T |
|
| Q |
218 |
tgtatagtggatgcaacaagtccctctcaatatttattggtcatgctaggtgtgcacattgcaaagcacaaaaatgtaacataaaattcatttattgtag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187849 |
tgtatagtggatgcaacaagtccctctcaatatttattggtcatgctaggtgtgcacattgcaaagcacaaaaatgtaacataaaattcatttattgtag |
40187750 |
T |
|
| Q |
318 |
tgaaacttgctattctatttt |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40187749 |
tgaaacttgctattctatttt |
40187729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University