View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_84 (Length: 290)
Name: NF15163_high_84
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_84 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 321342 - 321093
Alignment:
| Q |
17 |
aggatgctagagaaagaaagaaacaccaaatcgatctatttattttccaaagcagtgcaaaattacaaatttaaaaaatggtgattgatttttgtagagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
321342 |
aggatgctagagaaagaaagaaacaccaaatcgatctatttatttttcaaagcagtgcaaaattacaaatttaaaaaatggtgattgatttttgtagagg |
321243 |
T |
 |
| Q |
117 |
taaaaaagaagttaatctttgtaacaaaaaagtaaaaagtgggcctattattaaatgattaacnnnnnnnnnnngttaattttggtgttgacttttttgt |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
321242 |
taaaaaag---------tttgtaacaaaaaagtaaaaagtgggcctatcattaa---attaac-aaaaaaaaaagttaattttggtgttgacttttttgt |
321156 |
T |
 |
| Q |
217 |
atttttcgaaaccctaatggggttcatttcacatgtgcacaagcaattgcgaatcttcccttt |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
321155 |
atttatcgaaaccctaatggggttcatttcacatgtgcacatgcaattgcgaatcttcccttt |
321093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University