View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_87 (Length: 287)
Name: NF15163_high_87
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_87 |
 |  |
|
| [»] scaffold0519 (2 HSPs) |
 |  |  |
|
| [»] scaffold0692 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
| [»] scaffold0766 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0129 (2 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |  |
|
| [»] scaffold0181 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0729 (2 HSPs) |
 |  |  |
|
| [»] scaffold0400 (1 HSPs) |
 |  |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |  |
|
| [»] scaffold0459 (2 HSPs) |
 |  |  |
|
| [»] scaffold0366 (4 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0481 (1 HSPs) |
 |  |  |
|
| [»] scaffold0048 (2 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 5e-59; HSPs: 93)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 27634540 - 27634679
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacagatttc |
100 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27634540 |
ctcatcgttacaaaaccggcttgtgaggtgaggattgcccccactcataaacacattgtcaggccatgtcctatccgatgtgggactcttaacagatttc |
27634639 |
T |
 |
| Q |
101 |
atagaaatgccctttatcgttccagacaaataggaaaagt |
140 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27634640 |
acagaaatgccctttatcgttcgagacaaataggaaaagt |
27634679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 183 - 280
Target Start/End: Original strand, 27634723 - 27634821
Alignment:
| Q |
183 |
ggcacacatcttcatcttctttatcatctcttcacatgaattttcaacaaaaaatctaa-gcttcaatctaaaatccagaaattccctaacttcttctc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27634723 |
ggcacacatcttcatcttctttatcatctcttcacatgaatcttcaacaaaaaatccaacgcttcaatccaaaatccagaaattccctaacttcttctc |
27634821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 27634105 - 27634198
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
27634105 |
ctcatccttacaaaatcggtttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
27634198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 22863525 - 22863440
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| | || |||||||||||||||||||||| |
|
|
| T |
22863525 |
acaaaaccggcttgtggggtgaggattgcccccacttataaacacattgtcaggccatcttctgtccgatgtgagactcttaacag |
22863440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 28245559 - 28245643
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
28245559 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca |
28245643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 39902596 - 39902680
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
39902596 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
39902680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 35788708 - 35788626
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
35788708 |
aaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatctgatgtgggactcttaaca |
35788626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 400598 - 400682
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
400598 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcagaccatctcatatctgatgtgagactcttaaca |
400682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 35788945 - 35788861
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
35788945 |
acaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca |
35788861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 50543363 - 50543447
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
50543363 |
acaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcagaccatcacctatccgatgtggggctcttaaca |
50543447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 21685049 - 21684964
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21685049 |
acaaaatcggcttgtgaggtgaggatttatcccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaacag |
21684964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 22845480 - 22845565
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||||||| ||||||| |||| |||||| |||||||||||| |
|
|
| T |
22845480 |
acaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcatatctgatgtgggactcttaacag |
22845565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 31254431 - 31254524
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||||||| |||| ||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
31254431 |
ctcatcctcacaaaaccggtttgtaaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
31254524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 50543600 - 50543685
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
50543600 |
acaaaaccggcttgtgaggtgaggattgcccccacttatacacacattgtcaggccatcacctatccgatgtgggactcttaacag |
50543685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 5846197 - 5846113
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||| ||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
5846197 |
acaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgagactcttaaca |
5846113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 22231106 - 22231190
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
22231106 |
acaaaaccggcttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcctatccgatgtaggactcttaaca |
22231190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 22827589 - 22827509
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||| ||||||| |||| |||||||||||||| ||||||| |
|
|
| T |
22827589 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacgttgtcaggccatctcctatccgatgtgggactctt |
22827509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35796775 - 35796859
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
35796775 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcatgccatgtcctgtccgatgtggaactcttaaca |
35796859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 96
Target Start/End: Complemental strand, 9279278 - 9279192
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
9279278 |
acaaaaccggctagtgaggtgatgattgcccccacttataaacacattgtcaggccatcacctatccgatgtgcgactcttaacaga |
9279192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 35645800 - 35645882
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
35645800 |
aaaactggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctattcgatgtgggactcttaaca |
35645882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 13555500 - 13555584
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||| |||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
13555500 |
acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca |
13555584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 21498405 - 21498321
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
21498405 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21498321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 21498846 - 21498762
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
21498846 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21498762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 52559618 - 52559534
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||||||||||||||| |||||| ||||| |||||||||| |||||| |
|
|
| T |
52559618 |
acaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatgtcatatccaatgtgagacttttaaca |
52559534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 6218488 - 6218406
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| ||||||||||||| || ||| ||||||| |||||||||||||||||| |
|
|
| T |
6218488 |
aaaaccggcttgtgaggtgatgattgcccccacttataaacacattgttaggtcatctcctatctgatgtgagactcttaaca |
6218406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 5846431 - 5846346
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||| ||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
5846431 |
tacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactcttaaca |
5846346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 20822024 - 20821940
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
20822024 |
acaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
20821940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 44118892 - 44118972
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||| |||||||| |||||||||| |||||||| |||||||||||||||| |||| || ||||||||||| ||||||| |
|
|
| T |
44118892 |
acaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttatccgatgtgggactctt |
44118972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 6778685 - 6778779
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactc-ataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| | || || |||||| ||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
6778685 |
ctcaaccttacaaaaccggcttgtgaggtgaggattgtctcctctttataaactcattgtcaggccatgtcatatccgatgtgggactcttaaca |
6778779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 9685681 - 9685599
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||| ||||| |||||| ||||| |||||| | ||||||||||| |
|
|
| T |
9685681 |
aaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttagaccaactcctaaccgatgcgggactcttaaca |
9685599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 37836131 - 37836049
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| ||||| ||||||| || ||||||||| ||||||||| ||||||||| |
|
|
| T |
37836131 |
acaaaaccggcttgtaaggagaggattgcccccacttataaatacattgttaggccatgtcctgtccgatgtgggactcttaa |
37836049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 17 - 94
Target Start/End: Original strand, 11036786 - 11036863
Alignment:
| Q |
17 |
cggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
11036786 |
cggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgttgtactcttaaca |
11036863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 52559856 - 52559783
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
52559856 |
tacaaaaccggcttgtgaggtgagaattgctcccacttataaacacattgtcaagtcatgtcctatccgatgtg |
52559783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 6218255 - 6218175
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||| ||||||| ||||| | |||| |||||||||||||||||||||| |
|
|
| T |
6218255 |
acaaaaccgtcttgtgaggtgaagattgcccccacttataaacatattgtgaagccatctcctatccgatgtgagactctt |
6218175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 25052903 - 25052819
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
25052903 |
acaaaaccggcttgtgaggtgcggattacccccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaaca |
25052819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 53814962 - 53815046
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||| |
|
|
| T |
53814962 |
acaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
53815046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 28246118 - 28246169
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28246118 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtca |
28246169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 14783220 - 14783306
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| || | ||||||| ||||||||| || ||||| |||||||| ||||||||||||| |
|
|
| T |
14783220 |
acaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccgatgtgggactcttaacaga |
14783306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 53828556 - 53828642
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||| |||||| || ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
53828556 |
acaaaatcggcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaacaga |
53828642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 17222678 - 17222727
Alignment:
| Q |
3 |
catccttacaaaaccggcttgtggggtgaggattgcccccactcataaac |
52 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
17222678 |
catccttacaaaaccggcttgtgaggtgaggattgcccccacttataaac |
17222727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 1518215 - 1518131
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| ||||||| |||||||| || ||||| |||||||| ||||| ||||| |
|
|
| T |
1518215 |
acaaaaccggcttgtgagctgaggattgcccccacttataaacaaattgtcaggtcaactcctaaccgatgtgggactcataaca |
1518131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5398245 - 5398328
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| || |||||||||||||||||||||| | | ||| ||||| ||||||||||| |
|
|
| T |
5398245 |
acaaaaccggcttgtgagatgaggattgcccct-cttataaacacattgtcagaccatgacttgtccaatgtgggactcttaaca |
5398328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5398509 - 5398592
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| | ||||||||||||| || ||||| | | ||||||||| ||||||||||| |
|
|
| T |
5398509 |
acaaaaccggcttgtgaggtgaggattg-ccccagttataaacacattgttaggccatgacttgtccgatgtgggactcttaaca |
5398592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 21750075 - 21750159
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||| ||||| | ||||||| | ||| || |||||||||||||||| |||||| |
|
|
| T |
21750075 |
acaaaaccggcttgtgaggtgaggaatgctcccacttataaagatattgtcatatcatctcttatccgatgtgagacttttaaca |
21750159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 22231341 - 22231425
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| | ||| |||| ||| || |||||||||| ||||||||||| |
|
|
| T |
22231341 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaatatattctcaggtcatatcatatccgatgtaggactcttaaca |
22231425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 27464281 - 27464361
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||| ||||||| || || ||||||||||| ||||||| |
|
|
| T |
27464281 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacactttgtcaggaaatctcttatccgatgtgggactctt |
27464361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35819161 - 35819245
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| || ||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
35819161 |
acaaaactggcttgtgaggcgaggattgcccccacatataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
35819245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 53828322 - 53828406
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||| || || ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
53828322 |
acaaaatcggtttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
53828406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 2220996 - 2221047
Alignment:
| Q |
5 |
tccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
2220996 |
tccttacaaaaccggcttgtgaggtgaggattgcccccacctataaacacat |
2221047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 92
Target Start/End: Complemental strand, 35175087 - 35175004
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||| || |||||| ||||| |||| ||||| || |||||||||||||||| |||||| || ||||||||| ||||||||| |
|
|
| T |
35175087 |
tacaaaatcgacttgtgaggtgatgattaccccctcttataaacacattgtcaggccatgttctgtccgatgtgggactcttaa |
35175004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 22445503 - 22445415
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgc-ccccactcataaacacat---tgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||| ||||||||||||| ||||||| |||||||||| ||||||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
22445503 |
acaaaaccgacttgtagggtgaggattgccccccactaataaacacattaatgtcagatcatctcctatcagatatgagactcttaaca |
22445415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 7806605 - 7806686
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||| | |||||||||||||||| ||||||||||||| ||||| | ||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
7806605 |
ctcatcatcacaaaaccggcttgtgaggtgaggattgccgccacttaaaaatacattgtcaggccaactcctaaccgatgtg |
7806686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 18528490 - 18528575
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| | | |||||||||||| || || |||| |||||||||||||| ||||||| |
|
|
| T |
18528490 |
acaaaaccgatttgtgaggtgaggattgcccccaattgttaacacattgtcacactatctcctgtccgatgtgagacttttaacag |
18528575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 9685449 - 9685365
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||||||| ||||||| ||||| || ||| ||||| ||||||| ||||||||||| |
|
|
| T |
9685449 |
acaaaaccgacttgtgaggtgaggattggccccacttataaacaaattgttaggccaactcctaaccgatgtaggactcttaaca |
9685365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 12869062 - 12869146
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||| |||||||| ||| | ||| | ||||| ||||||||||| |
|
|
| T |
12869062 |
acaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaggccaactgctaactgatgtaggactcttaaca |
12869146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35609523 - 35609607
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| |||||||| | | || |||| ||| |||| ||||| ||||||||||| |
|
|
| T |
35609523 |
acaaaaccgacttgtgaggtgaggattgcccccacttataaacacttgtttaggccatctcccatccaatgtgggactcttaaca |
35609607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35797010 - 35797094
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||| ||||||| ||||||| ||| |||| |||||| || ||||||||||| |
|
|
| T |
35797010 |
acaaaactggtttgtgaggtgaggattgcccccacttataaacatattgtcatgtcatctcctgtccgatatgggactcttaaca |
35797094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 980092 - 980167
Alignment:
| Q |
19 |
gcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||| ||| |||| || ||||| |||||||| ||||||||||| |
|
|
| T |
980092 |
gcttgtgaggtgaggattgcccccacttataaacaaattctcaggtcaactcctaaccgatgtgggactcttaaca |
980167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 6778521 - 6778560
Alignment:
| Q |
55 |
attgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6778521 |
attgtcagaccatgtcctatccgatgtgggactcttaaca |
6778560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 94
Target Start/End: Original strand, 11036545 - 11036628
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||| ||||||||||||||| ||| |||||| ||| || ||||||||||| |
|
|
| T |
11036545 |
caaaaccggcttgtgaggtgatgattgccccaacttataaacacattgtcatgtcatcacctatctgatttgggactcttaaca |
11036628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 40717256 - 40717323
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||||| || || |||||| ||||||||||| |
|
|
| T |
40717256 |
ggtgaggattgtccccacttataaacacattgtcaggtcatgttctgtctgatgtgggactcttaaca |
40717323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 13555282 - 13555364
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| || |||| |||||||||||| ||||||||||| ||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
13555282 |
aaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatccgatgtggaactcttaaca |
13555364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 16066117 - 16066064
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
16066117 |
tacaaaaccagtttgtgaggtgaggattgcccccacttataaacaaattgtcag |
16066064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 18528261 - 18528334
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| ||||||||||||| ||||| |||||||||||| || |||| || ||| |||||||||||||||||| |
|
|
| T |
18528261 |
ttgtgaggtgaggattgccgccacttataaacacattgccatgccatctcgtatttgatgtgagactcttaaca |
18528334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 22822401 - 22822356
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacaca |
55 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
22822401 |
acaaaaccggcttgtgtggtgaggatttcccccacttataaacaca |
22822356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 94
Target Start/End: Original strand, 54055072 - 54055149
Alignment:
| Q |
17 |
cggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||| ||||| || ||| | ||| |||||||| ||||||||||| |
|
|
| T |
54055072 |
cggcttgtgagatgaggattgcccccacttataaacaaattgttaggccaacttctaaccgatgtgggactcttaaca |
54055149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 2463857 - 2463805
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||| ||| |||||||| |
|
|
| T |
2463857 |
acaaaaccggcttgtgaggtaaggattgcccccacttatacacaaattgtcag |
2463805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 34358063 - 34358115
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
||||||||||||| || |||||||||||||||| | |||||||||||||||| |
|
|
| T |
34358063 |
acaaaaccggcttctgatgtgaggattgcccccatttataaacacattgtcag |
34358115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 35609744 - 35609788
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
35609744 |
acaaaaccggcttgtgaggtgaggattggccccacttataaacac |
35609788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 42662514 - 42662430
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| | |||| ||| ||| | | ||||||||||||||||||||| |||||| ||||||| || |||||||| |
|
|
| T |
42662514 |
acaaaaccggtttgtgagatgagaattatccctatttataaacacattgtcagaccatctcctattcgatgtgggattcttaaca |
42662430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 53814707 - 53814759
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
53814707 |
acaaaaccggcttgtgaggtgaggattatccccacttataaacaaattgtcag |
53814759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 12005502 - 12005537
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccact |
45 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12005502 |
acaaaaccggcttgtgaggtgaggattgcccccact |
12005537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 94
Target Start/End: Complemental strand, 17111790 - 17111735
Alignment:
| Q |
39 |
ccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||||| |||||| ||||||||||| |
|
|
| T |
17111790 |
ccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
17111735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 5488462 - 5488424
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5488462 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
5488424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 7926379 - 7926333
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
7926379 |
acaaaaccggcttgtgttgtgaggaatgcccccacttataaacacat |
7926333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 12016692 - 12016730
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12016692 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
12016730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 12016900 - 12016938
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12016900 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
12016938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 25753614 - 25753652
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25753614 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
25753652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 26549688 - 26549614
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgc-ccccactcataaacacattgtcagaccatgtcctatccgatgtga |
83 |
Q |
| |
|
|||||||||||||||| | | |||||| | ||||||| |||||||||| ||||| |||| || |||||||||||| |
|
|
| T |
26549688 |
acaaaaccggcttgtgagataaggattactccccacttataaacacatcgtcaggccatctcttatccgatgtga |
26549614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 28395272 - 28395234
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28395272 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
28395234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 235
Target Start/End: Original strand, 37368907 - 37368957
Alignment:
| Q |
185 |
cacacatcttcatcttctttatcatctcttcacatgaattttcaacaaaaa |
235 |
Q |
| |
|
|||| ||||||||| | || ||||||||||||||||||| ||||||||||| |
|
|
| T |
37368907 |
cacaaatcttcatcattttcatcatctcttcacatgaatcttcaacaaaaa |
37368957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 43943768 - 43943730
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43943768 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
43943730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 7892599 - 7892542
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
|||||||||| ||||| | ||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
7892599 |
acaaaaccggattgtgagatgaaaattgcctccacttataaacacattgtcagaccat |
7892542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 10362032 - 10362116
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagac--catgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||| ||| |||||| ||||| |||||| || ||| ||||||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
10362032 |
acaataccagcttgtaaggtgatgattgctcctacttataaacacactgtcagaggtcatgtcatatccgatgtgagactcttaa |
10362116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 94
Target Start/End: Original strand, 45784918 - 45784995
Alignment:
| Q |
17 |
cggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||| ||||||| ||||| ||||||| | ||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
45784918 |
cggcttgtgaggtgatgattgccgccacttataaacatactgtcaagtcatcacctatccgatgtgggactcttaaca |
45784995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 53699067 - 53698998
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||| ||||||||| ||| || ||| || |||| ||||||| |
|
|
| T |
53699067 |
ttgtgaggtgaggattgcccacacttataaacatattgtcagatcatctcttattcgttgtgggactctt |
53698998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 91
Target Start/End: Original strand, 13611783 - 13611863
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
||||||| |||||| |||||||||| ||||||| ||||| | ||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
13611783 |
caaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaactctta |
13611863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 24513395 - 24513427
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccact |
45 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24513395 |
aaaccggcttgtgaggtgaggattgcccccact |
24513427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 40717474 - 40717526
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
||||||||| ||| || ||||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
40717474 |
acaaaaccgacttttgaggtgaggattgcccccacttataaacaaattatcag |
40717526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 40726773 - 40726737
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccact |
45 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
40726773 |
tacaaaaccggcttgtgaggtgaggatttcccccact |
40726737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 42684826 - 42684870
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| | |||||||| |
|
|
| T |
42684826 |
acaaaaccggcttgtgaggtgatgattgcccccatttataaacac |
42684870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 64
Target Start/End: Original strand, 50816529 - 50816589
Alignment:
| Q |
4 |
atccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagac |
64 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| | ||||| |||| |||||| |
|
|
| T |
50816529 |
atccttacaaaaccagcttgtaaggtgaggattgcccccatttataaattcattttcagac |
50816589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 54054838 - 54054922
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| |||||| || |||||| |||||||||||| ||||||| ||||| || || ||||| ||||||| ||||||||||| |
|
|
| T |
54054838 |
acaaaaacggcttatgaggtgagaattgcccccacttataaacaaattgttaggtcaactcctaatcgatgtgggactcttaaca |
54054922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 85)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16419553 - 16419469
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16419553 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
16419469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 37812292 - 37812385
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
37812292 |
ctcatccttacaaaatcgacttgtgaggtgaggattgtccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
37812385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17525371 - 17525455
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
17525371 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcatgtccgatgtgggactcttaaca |
17525455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 37812522 - 37812615
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||||||||||| |||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
37812522 |
ctcatccttacaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcttatccgatgtgggactcttaaca |
37812615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 2029820 - 2029736
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
2029820 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
2029736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 17719451 - 17719367
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
17719451 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
17719367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 40379477 - 40379563
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||| |||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
40379477 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaacaga |
40379563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 14466443 - 14466528
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| |||||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
14466443 |
acaaaaccggcttgtaaggtgaggattgctcccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag |
14466528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 2324291 - 2324207
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
2324291 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
2324207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5711472 - 5711556
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| |||| ||||||||| ||||||||||| |
|
|
| T |
5711472 |
acaaaaccggcttgttaggtgaggattgcccccacttataaacacattgtcaggccatttcctttccgatgtgggactcttaaca |
5711556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 40379242 - 40379326
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||| |||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
40379242 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
40379326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 93147 - 93239
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
93147 |
ctcatccttacaaaaccggcttgtaaggtgaggagtgcccccacttataaacacattgtcag-gcatcacctatccgatgtgggactcttaaca |
93239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 94044 - 94137
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| || ||||||||| |||||| ||||||||||||||||||| ||||||||| |||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
94044 |
ctcattctcacaaaaccgacttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
94137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 2030055 - 2029971
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||||||||| |||||| | ||||||||| ||||||||||| |
|
|
| T |
2030055 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcatgtccgatgtgggactcttaaca |
2029971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5711708 - 5711792
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
5711708 |
acaaaaccggcttttaaggtgatgattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
5711792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 15124581 - 15124665
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| |||||| || |||| |||||||||||||| ||||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15124581 |
acaaaatcggcttatgaggtggggattgcccccacttataaacatattgtcagaccatgttctatccgatgtgggactcttaaca |
15124665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 94
Target Start/End: Original strand, 18607034 - 18607126
Alignment:
| Q |
2 |
tcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||| ||||||| |||||||||||||||| |||| |||||| ||||||||||||| |||| |
|
|
| T |
18607034 |
tcatccttacaaaaccggcttttgaggtgatgattgtccccactaataaacacattgtcaggccatcacctatctgatgtgagactctaaaca |
18607126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 32884158 - 32884074
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
32884158 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
32884074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 33606087 - 33606171
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||| |||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
33606087 |
acaaaaccggtttgtgaggtgaggattgcccctacttataaacacattttcaggccatctcctatccgatgtgggactcttaaca |
33606171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 28407826 - 28407911
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| ||||| || ||| ||||| |||||||| |||||||||||| |
|
|
| T |
28407826 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttaggccaattcctaaccgatgtgggactcttaacag |
28407911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 2324525 - 2324441
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| | ||| |||||||| ||||||||||| |
|
|
| T |
2324525 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaacttctaaccgatgtgggactcttaaca |
2324441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 4662270 - 4662198
Alignment:
| Q |
22 |
tgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||| |||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
4662270 |
tgtgaggtgaggattgcccccacttataaacatattgtcaggtcatgtcctatccgatgtgggactcttaaca |
4662198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 5509364 - 5509280
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||| | ||| ||||| | |||||| ||||||||||| |
|
|
| T |
5509364 |
acaaaaccggcttgtggggtgaggattgcccccacttataaacaaattgtcgggccaactcctaactgatgtgggactcttaaca |
5509280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16533598 - 16533514
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |||||||| ||| ||||||||||| |
|
|
| T |
16533598 |
acaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtcaggccatcacctatccggtgtaggactcttaaca |
16533514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17854962 - 17855046
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||||| |||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
17854962 |
acaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggtcaactcctaaccgatgtgagactcttaaca |
17855046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25082570 - 25082654
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||| ||| ||||||||||||||||||||| || |||| ||| |||||||||||||| |
|
|
| T |
25082570 |
acaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcagaccatctcttatctgatatgagactcttaaca |
25082654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 37840388 - 37840304
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||| |||||||||||||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
37840388 |
acaaaaccggcttgtgaggtgatgattgcctccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca |
37840304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 5509130 - 5509048
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||||| ||||||| |||||||||| |||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
5509130 |
acaaaaccagcttgtgaggtgaggattacccccacttataaacaaattgtcagaccaactcctaaccgatgtgtgactcttaa |
5509048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 5851715 - 5851803
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgt---cagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||| ||||||| ||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
5851715 |
acaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcagcaggccatgtcctgtccgatgtgggactcttaacag |
5851803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 28 - 94
Target Start/End: Original strand, 12343801 - 12343867
Alignment:
| Q |
28 |
gtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
12343801 |
gtgaggattgcccccacttataagcacattgtctgaccatctcctatccgatgtgggactcttaaca |
12343867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 37769976 - 37770061
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||| ||||||| ||||||| |||| ||||| |||||||| |||||||||||| |
|
|
| T |
37769976 |
acaaaaccggcttatgaggtgaagattgcccccacttataaacaaattgtcaaaccaactcctaaccgatgtgggactcttaacag |
37770061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17525132 - 17525216
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| | |||||||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
17525132 |
acaaaaccggcttgtgcggtgaggattcttcccatttataaacacattgtcaggtcatgtcctgtccgatgtgagacttttaaca |
17525216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 29718379 - 29718295
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||||| ||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
29718379 |
acaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaagccaactcctaaccgatgtgggactcttaaca |
29718295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 32356436 - 32356353
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||| || | ||||||||||||||||||||| |
|
|
| T |
32356436 |
acaaaactggcttgtggg-tgaggattgcccccacttataaacacattgtcatgtcatctcatgtccgatgtgagactcttaaca |
32356353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 40149036 - 40149120
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||| ||||||| ||||||||| ||| || ||| | |||||||||||||||||||||||| |
|
|
| T |
40149036 |
acaaaatcggcttgtgaggtgaggattgtccccacttataaacacactgttaggtcatcttctatccgatgtgagactcttaaca |
40149120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 42639647 - 42639731
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||| ||||| ||||| | |||||||||||||||||||||||| ||| | ||||| ||||||||||| |
|
|
| T |
42639647 |
acaaaaccagcttgtgaggtgacgattgtccccatttataaacacattgtcagaccatgtcatattcaatgtgggactcttaaca |
42639731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 15518820 - 15518727
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| |||||| ||| |||||||||| |||| |||||||||||||||| | | ||||||| ||||| ||||||||||| |
|
|
| T |
15518820 |
ctcatccttacaaaaccaacttgtgaggttaggattgccctcacttataaacacattgtcaggctgtcacctatccaatgtgggactcttaaca |
15518727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 9927953 - 9927893
Alignment:
| Q |
19 |
gcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgat |
79 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
9927953 |
gcttgtgaggtgaggattacccccacttataaacacattgtcagaccatcttctatccgat |
9927893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 15464820 - 15464736
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||| | | ||||||||||||||||| || ||| ||||||| |||||||||| |
|
|
| T |
15464820 |
acaaaactggtttgtgaggtgaggattgcccccacttaaatacacattgtcagaccatctcatatttgatgtgaaactcttaaca |
15464736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 19191643 - 19191727
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||||| | |||||| ||| ||||| |||||| | ||||||||||| |
|
|
| T |
19191643 |
acaaaaccggcttgtgaggtgaggattgtccccacttataaacaaactgtcaggccaactcctaaccgatgggggactcttaaca |
19191727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 27 - 90
Target Start/End: Complemental strand, 14927136 - 14927073
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||| || ||||||||||| ||||||| |
|
|
| T |
14927136 |
ggtgaggattgcccccacttataaacacattgtcaggtcatctcttatccgatgtgtgactctt |
14927073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 36351968 - 36352043
Alignment:
| Q |
19 |
gcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||| |||| ||||||| |||||||||||||||| | | ||||||||||||| |||||||||||| |
|
|
| T |
36351968 |
gcttgtgaggtgagaattgtccccacttataaacacattgtcaggtcgtctcctatccgatgtaagactcttaaca |
36352043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 35418449 - 35418531
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| | ||||| | ||| ||||||||||||| |||||||||||| |
|
|
| T |
35418449 |
aaaaccggcttgtgaggtgaggattgcccccacctataaatatattgttatgtcatctcctatccgatgtaagactcttaaca |
35418531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 81
Target Start/End: Original strand, 44404196 - 44404262
Alignment:
| Q |
15 |
accggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| | ||||| ||||||||||||| |||||||||||| |
|
|
| T |
44404196 |
accggcttgtgaggtgatgattgcccccacttacaaacatattgtcagaccatcacctatccgatgt |
44404262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 93471 - 93520
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataa |
50 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
93471 |
ctcatcctcacaaaaccggcttgtgaggtgaggattgcccccacttataa |
93520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 93744 - 93793
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataa |
50 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
93744 |
ctcatcctcacaaaaccggcttgtgaggtgaggattgcccccacttataa |
93793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 44403950 - 44404043
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||| | |||| | |||||||||||||| | || ||||| |||||| ||||||||||| |
|
|
| T |
44403950 |
ctcatccttacaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca |
44404043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17854725 - 17854809
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| | ||| ||||||||||||| ||||||| |||||||| | | ||||| |||||||| ||||||||||| |
|
|
| T |
17854725 |
acaaaaccgacttgtgagatgatgattgcccccacttataaacagattgtcaggctaactcctaaccgatgtgggactcttaaca |
17854809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 24396151 - 24396067
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||||||||| ||| |||| ||| ||||||| |||||||| |||| | ||||||||||| ||||||||||| |
|
|
| T |
24396151 |
acaaaaccgacttgtggggtgataattacccctacttataaacatattgtcaggccatcttatatccgatgtgggactcttaaca |
24396067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 27897639 - 27897722
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| ||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
27897639 |
acaaaaccgacttgtgaggtgagaattgcccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27897722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 40718240 - 40718324
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| |||| ||||||| ||||| || || ||||| |||||||||||||||||||| |
|
|
| T |
40718240 |
acaaaaccggtttgtgaggtgatgattgccctcacttataaacaaattgttaggtcaactcctaaccgatgtgagactcttaaca |
40718324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 27036447 - 27036529
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| || || |||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
27036447 |
tacaaaaccggcttatgagg---ggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27036529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 93
Target Start/End: Original strand, 36352192 - 36352275
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||| ||||||||||||| ||| || || |||| |||| ||||||||||| |
|
|
| T |
36352192 |
acaaaaccggcttttgaggtgatgattgcccccacttataaacacattgttagattatctcaaatccaatgtaagactcttaac |
36352275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 3738982 - 3738900
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||||||||| ||| ||| | ||||||||||| ||||||||||| |
|
|
| T |
3738982 |
aaaaccggtttgtgatgtgaggattgcccccacttataaacacattatcatgtcatcttctatccgatgttggactcttaaca |
3738900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 10584992 - 10585034
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgccccca |
43 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
10584992 |
ctcatccttacaaaaccgacttgtgaggtgaggattgccccca |
10585034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 11020602 - 11020552
Alignment:
| Q |
17 |
cggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
11020602 |
cggcttgtgaggtgaggattgcctccacttataaacacattttcagaccat |
11020552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 37 - 94
Target Start/End: Original strand, 14466235 - 14466292
Alignment:
| Q |
37 |
gcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||||| ||||||||| |||||||||| |
|
|
| T |
14466235 |
gcccccacttataaacacattgttaggccatgtcctgtccgatgtggaactcttaaca |
14466292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 15124816 - 15124901
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtccta-tccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||| |||| |||||||| |||| ||||||||| ||||| |||||||| || || |||||||||||||||||| |
|
|
| T |
15124816 |
acaaaaccgaattgtgaagtgaagattgccctcacttataaacacactgtcataccatgtcttaatctgatgtgagactcttaaca |
15124901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 31700778 - 31700865
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgagg---attgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||| | ||||||| |||| |||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
31700778 |
acaaaaccggcttgtgaggtggtgggaattgccctcacttataaacacattgtcaggccatcacctatccgatgtgtaactcttaaca |
31700865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 8424939 - 8424855
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| || ||||| ||||| ||||||||||||| ||||| | |||||||||||| ||||| | |||||| |||| |||||| |
|
|
| T |
8424939 |
acaaaactggtttgtgaggtgatgattgcccccacttataaataaattgtcagaccaactcctaactgatgtgggacttttaaca |
8424855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 10523304 - 10523224
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||| ||||||| |||||||| || || ||| | ||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
10523304 |
acaaaactagcttgtgaggtgaggaatgttcctacttaaaaacacattgtcagaccatctcttatccgatgtgggactctt |
10523224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 14927344 - 14927292
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||| |||||| || ||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
14927344 |
acaaaatcggcttatgaggtgaggattgcccccacttataaacatattgtcag |
14927292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 19544404 - 19544455
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
19544404 |
acaaaaccggcttgtgaggtgag-attgcccccacttataaacacattatcag |
19544455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 36316084 - 36316168
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| ||||||| |||||||| ||| | ||| | |||||| ||||||||||| |
|
|
| T |
36316084 |
acaaaactggcttgtaatgtgaggattgcccccacttataaacaaattgtcaggccaacttctaactgatgtgggactcttaaca |
36316168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 38629892 - 38629812
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||| |||||| | ||||||||| ||| ||| ||||| ||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
38629892 |
acaaaaccgacttgtgagatgaggattgtcccaacttataaatacattgtcatgtcatttcttatccgatgtgagactctt |
38629812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 40149261 - 40149343
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| |||||| |||||||| ||| ||||||||||||| || ||| || ||||||||||| ||||||||||| |
|
|
| T |
40149261 |
acaaaaccgacttgtgaggtgagaattgcccc-acttataaacacattgttaggtcatctcatatccgatgtg-gactcttaaca |
40149343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 21591831 - 21591748
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||| || ||||| |||||||||| ||| ||||||| |||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
21591831 |
aaaaccgacttatgaggtgaagattgccccccacttataaacaaattgtcagaccaactcctaatcgatgtgggactcttaaca |
21591748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 24395903 - 24395837
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactc |
88 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| || |||| |||||| |||||| ||||| |
|
|
| T |
24395903 |
ttgtgaggtgaggattgcccc-actcataaacacattgttaggccatcacctatctgatgtgggactc |
24395837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 33606322 - 33606369
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacatt |
57 |
Q |
| |
|
||||||| |||||||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
33606322 |
acaaaactggcttgtgaggtgaggattacccccacttataaacacatt |
33606369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 883610 - 883648
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
883610 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
883648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 883945 - 883907
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
883945 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
883907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 13486374 - 13486300
Alignment:
| Q |
21 |
ttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
13486374 |
ttgtgaggtgaggattgccccccacttataaataaattgtcaggccaactcctaaccgatgtgggactcttaaca |
13486300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 15988264 - 15988218
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||| |||| |
|
|
| T |
15988264 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaaaacat |
15988218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 17727499 - 17727461
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17727499 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
17727461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 20998998 - 20999036
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20998998 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
20999036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 33985780 - 33985818
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33985780 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
33985818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 34775452 - 34775414
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34775452 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
34775414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 25441791 - 25441750
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgccccc |
42 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
25441791 |
ctcatccttacaaaaccggcttgtaaggtgaggagtgccccc |
25441750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 789461 - 789501
Alignment:
| Q |
47 |
ataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||| |
|
|
| T |
789461 |
ataaacacattgtcaggccatttcttatccgatgtgagact |
789501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 12343686 - 12343726
Alignment:
| Q |
54 |
cattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
12343686 |
cattgtcaaaccatctcctatccgatgtgggactcttaaca |
12343726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 12431993 - 12431957
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattg |
37 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12431993 |
ctcatccttacaaaaccggcttgtaaggtgaggattg |
12431957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 15988463 - 15988423
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataa |
50 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
15988463 |
acaaaactggcttgtgaggtgaggattgcccccacttataa |
15988423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 24666265 - 24666317
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
24666265 |
acaaaatcggtttgtgaggtgaggattgccccaactaataaacacattttcag |
24666317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 39108315 - 39108279
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattg |
37 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39108315 |
ctcatccttacaaaaccggcttgtaaggtgaggattg |
39108279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 40010067 - 40010031
Alignment:
| Q |
3 |
catccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40010067 |
catccttacaaaaccggcttgtaaggtgaggattgcc |
40010031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 91)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16239642 - 16239558
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16239642 |
acaaaaccggcttgtgaggtgaggtttgcccccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca |
16239558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 20327647 - 20327731
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
20327647 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcctatccgatgtgggattcttaaca |
20327731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 39269381 - 39269298
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||| ||||| ||||||||||| |
|
|
| T |
39269381 |
caaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtgctctccaatgtgggactcttaaca |
39269298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 54567943 - 54567858
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
54567943 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatgtcctatccgatataggactcttaacag |
54567858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 11589836 - 11589752
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
11589836 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
11589752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 16926982 - 16927066
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | |||||||| |||||||| |||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
16926982 |
acaaaaccggcttgtgagatgaggattacccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca |
16927066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 22729151 - 22729067
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
22729151 |
acaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactctgaaca |
22729067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35038227 - 35038311
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
35038227 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
35038311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 20303097 - 20303181
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||| |||||||||| ||||||| ||||||||||| || |||||||| |
|
|
| T |
20303097 |
acaaaaccggtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggattcttaaca |
20303181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 20327882 - 20327966
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
20327882 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
20327966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35038461 - 35038545
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
35038461 |
acaaaaccagcttgtcaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
35038545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 45138835 - 45138907
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||| || ||||||||||| |
|
|
| T |
45138835 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccagaccatctcttatccgatgtg |
45138907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 4155608 - 4155526
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||| |||||||||||||||| || |||||||| ||||||| ||||||||||| |
|
|
| T |
4155608 |
aaaaccggcttttgaggtgaggattgtccccacttataaacacattgtcaggccttgtcctatgcgatgtgggactcttaaca |
4155526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 54368565 - 54368483
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||| |||| |||| | ||||| |||||| ||||||||||| |
|
|
| T |
54368565 |
aaaaccggcttgtgaggtgaggattgcccccacttataaacacattttcaggccatcttctatcggatgtgggactcttaaca |
54368483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 4155375 - 4155291
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||| |||||||| |||| | ||||||| ||||||||||| ||||||||||| |
|
|
| T |
4155375 |
acaaaaccggcttttgaggtgaggattgcccccacttataaacacgctgtctggccatgtcatatccgatgtgggactcttaaca |
4155291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 9273012 - 9272928
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||||||| ||| |||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
9273012 |
acaaaaccggcttgtgaggtgagggttgcccccacttataaacaaattatcaggccaattcctaaccgatgtgagactcttaaca |
9272928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 9273246 - 9273162
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
9273246 |
acaaaaccagcttgtgaagtgaggattgcccccacttataaacaaattgtcagaccaattcctaaccgatgtgggactcttaaca |
9273162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23691225 - 23691309
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| | | ||||| |||||||| ||||||||||| |
|
|
| T |
23691225 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23691309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23708025 - 23708109
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| | | ||||| |||||||| ||||||||||| |
|
|
| T |
23708025 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23708109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23708257 - 23708341
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||||| | ||||| | |||||| ||||||||||| |
|
|
| T |
23708257 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca |
23708341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23726481 - 23726565
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| | | ||||| |||||||| ||||||||||| |
|
|
| T |
23726481 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23726565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23726713 - 23726797
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||||| | ||||| | |||||| ||||||||||| |
|
|
| T |
23726713 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca |
23726797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23744937 - 23745021
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| | | ||||| |||||||| ||||||||||| |
|
|
| T |
23744937 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23745021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23745169 - 23745253
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||||| | ||||| | |||||| ||||||||||| |
|
|
| T |
23745169 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca |
23745253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 24063462 - 24063546
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| | | ||||| |||||||| ||||||||||| |
|
|
| T |
24063462 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
24063546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 27 - 94
Target Start/End: Complemental strand, 2123841 - 2123774
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
2123841 |
ggtgaggattgccctcacttataaacacattatcagatcatgtcctatccgacgtgagactcttaaca |
2123774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 38791494 - 38791568
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||| ||||||||||| || |||| ||||| ||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
38791494 |
ttgtgaggtgaggattgtcctcacttataaatacattgtcagaccatctcctatccgatgtgggactcttaacag |
38791568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 1723109 - 1723192
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| | ||| |||||||| ||||||||||| |
|
|
| T |
1723109 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaact-ctaaccgatgtgggactcttaaca |
1723192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16239878 - 16239794
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||| ||||||| |||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
16239878 |
acaaaaccgacttgtgaggtgagatttgcccccacttataaacatattgtcaggccatgtcctatccgtcgtgtgactcttaaca |
16239794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 31317279 - 31317196
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||||||| || | ||||| ||||||||||| ||||||||||| |
|
|
| T |
31317279 |
acaaaaccggcttgtgaggtgaggattgcccc-acttataaacacattgccatgctatgtcttatccgatgtgggactcttaaca |
31317196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 50083114 - 50083194
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||||| | |||| | ||||||||||||| ||||| |
|
|
| T |
50083114 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcgggccatcacttatccgatgtgaggctctt |
50083194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 30138116 - 30138029
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||| ||||||||||| |||| |||| |||||||||| ||||| ||||| |||| |
|
|
| T |
30138116 |
tacagaaccggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgatatgagattcttagcaga |
30138029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 30147667 - 30147580
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||| ||||||||||| |||| |||| |||||||||| ||||| ||||| |||| |
|
|
| T |
30147667 |
tacagaaccggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgatatgagattcttagcaga |
30147580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 94
Target Start/End: Complemental strand, 34992576 - 34992517
Alignment:
| Q |
35 |
ttgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
34992576 |
ttgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca |
34992517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 6487368 - 6487450
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| |||||||||| || ||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
6487368 |
aaaaccggcttgtgaggtgaggattacctccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
6487450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 24063694 - 24063748
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagac |
64 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24063694 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagac |
24063748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 45139004 - 45139081
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || ||||| ||||||| |||| || |||| |||||| |||| |
|
|
| T |
45139004 |
acaaaaccggcttgtgaggtgaggattgcccccacttattaacacgttgtcaggccatctcttatcagatgtgggact |
45139081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 8019019 - 8018935
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| ||||||| ||| |||| ||| | ||| |||||||| ||||||||||| |
|
|
| T |
8019019 |
acaaaaccggcttgtgaggtgaggattgcacccacttataaacaaattttcaggccaacttctaaccgatgtgggactcttaaca |
8018935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17001454 - 17001538
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| || ||| || ||||| ||||||||||||| |||||||||||||||||| | ||||||||||| || ||||||||||| |
|
|
| T |
17001454 |
acaaaatcgccttatgaggtgatgattgcccccacttataaacacattgtcagacgaactcctatccgatatgtgactcttaaca |
17001538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 39620377 - 39620293
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||| || |||| || || |||||||| |||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
39620377 |
acaaaactggcttatgaggtgcgggttacccccacttataaacacattgtcaggtcatcacctatccgatgtgagactcttaaca |
39620293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 472093 - 472144
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
472093 |
acaaaaccggcttgtgaggtaaggattgcccccacttataaacacattgtca |
472144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 92
Target Start/End: Original strand, 21809179 - 21809262
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||| | ||||||||||||| |||||||||||| |||||||| |
|
|
| T |
21809179 |
tacaaaaccggcttgtgaggtgtggattgcccccacttataattatattgtcagaccatcagctatccgatgtggcactcttaa |
21809262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 31317516 - 31317433
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| ||||||||| ||||| |||| ||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
31317516 |
caaaatcggcttgtgaggtgatgattttccccacttataaacacattgtcatgtcatgtcctatccgatgtaggactcttaaca |
31317433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 23691457 - 23691511
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagac |
64 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
23691457 |
acaaatccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagac |
23691511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 1800266 - 1800209
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||| ||| ||||||||||| |
|
|
| T |
1800266 |
acaaaaccggtttgtgaggtgaggattgcccccacttataaatacactgtcagaccat |
1800209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 90
Target Start/End: Original strand, 30179740 - 30179821
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||| | |||||| |||||||||| |||||||| |||||||||||||||| ||| || |||| |||||| ||||||| |
|
|
| T |
30179740 |
tacaaaactgacttgtgaggtgaggattacccccacttataaacacattgtcaggtcatctcttatctgatgtgggactctt |
30179821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 39683300 - 39683385
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccac-tcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||| | |||||||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
39683300 |
acaaaaccgtcttgtgaggtgaggattgcctccactttataaacacattgtcaggtcatcatctatccgatgtgggactcttaaca |
39683385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 52994829 - 52994748
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
|||||| ||||||||| || ||||||| | | ||| ||||||||||||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
52994829 |
acaaaatcggcttgtgatgtaaggattgtctcaacttataaacacattgtcagatcatgtcctattcgatgtgagacactta |
52994748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 54368764 - 54368691
Alignment:
| Q |
19 |
gcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||| |||||||||| |||| | ||||||||||| ||||||||| |
|
|
| T |
54368764 |
gcttgtgaggtgaggattgccaccacttataaatacattgtcaggccatcttctatccgatgttggactcttaa |
54368691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 7697431 - 7697514
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||||||||| || |||| |||||| | ||| |||||||||||||| ||||||||||| |
|
|
| T |
7697431 |
acaaaaccagcttgtgaggtgatgattgcccccacttat-aacatattgtctggtcatctcctatccgatgtgggactcttaaca |
7697514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 12930161 - 12930245
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||| || ||||||||||||| ||| || |||||||||||||||| |||||| |
|
|
| T |
12930161 |
acaaaaccggcttgtgaagtgagaattgtccccacatatgaacacattgtcaggtcatctcttatccgatgtgagacttttaaca |
12930245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 27670425 - 27670509
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| | || ||||||||||||||||||| ||||||| ||||||| ||| |||| |||||||| ||||||||||| |
|
|
| T |
27670425 |
acaaaaccggcctttgaggtgaggattgcccccacttataaacaatttgtcaggccaattcctgaccgatgtgggactcttaaca |
27670509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 49629656 - 49629573
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| |||| |||||||| ||||| ||||||||||| |||| |||| |||||||| ||||| |||||||||| |
|
|
| T |
49629656 |
acaaaaccggtttgtgaggtggggattgccgccacttataaacacattttcag-ccatctcctatccaatgtggaactcttaaca |
49629573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 13741136 - 13741199
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggatt-gcccccactcataaacacattgtcagaccatgtcctat |
74 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
13741136 |
aaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtcaaaccatctcctat |
13741199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 17638284 - 17638202
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||| |
|
|
| T |
17638284 |
caaaaccagcttgtgaggtgaggattg-ccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
17638202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 28087248 - 28087336
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggatt----gcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| |||| ||||||||| ||||||| ||||| || ||| ||||| |||||||||||||||||||| |
|
|
| T |
28087248 |
acaaaaccggcttgtgaggtgatgattaattgcccccacttataaacaaattgttaggccaactcctaaccgatgtgagactcttaaca |
28087336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 14991928 - 14991878
Alignment:
| Q |
6 |
ccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||||||||| | ||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
14991928 |
ccttacaaaactgacttgtggagtgaggattgcccccacttataaacacat |
14991878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 17638456 - 17638375
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||| ||||||| |||||||| ||| | ||| |||||||| ||||||||||| |
|
|
| T |
17638456 |
aaaaccggcttgtgagatgaggattgcccc-acttataaacaaattgtcaggccagcttctaaccgatgtgggactcttaaca |
17638375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 21832208 - 21832246
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21832208 |
ctcatccttacaaaaccggcttgtgaggtgaggattgcc |
21832246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 14839769 - 14839854
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||| ||||| ||||| ||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
14839769 |
tacaaaaccgacttgtaacgtgaggattgccccaacttataaatacattatcagaccatcaactatctgatgtgaaactcttaaca |
14839854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 18757893 - 18757816
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
||||||||| |||||| |||||||| ||||||||| |||||||||| ||||| || |||||||||||||| |||| |
|
|
| T |
18757893 |
acaaaaccgccttgtgatgtgaggatcgcccccacttataaacacatagtcaggtcaactcctatccgatgtgggact |
18757816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 53 - 94
Target Start/End: Complemental strand, 20303054 - 20303013
Alignment:
| Q |
53 |
acattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
20303054 |
acattgtcaggccatgtcctatccgatgtgggactcttaaca |
20303013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 23610404 - 23610488
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgt-cagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| |||| | |||||||| |||||||| |||||||| |||| |||||||| || ||||| ||| ||||||||||||| |
|
|
| T |
23610404 |
acaaaaccggcctgtgagttgaggattacccccacttataaacac-ttgtccagaccatctcttatccaatgggagactcttaaca |
23610488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 45828070 - 45828027
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaaca |
53 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
45828070 |
acaaaaccggcttgtgaggtgaggattgccccaacttataaaca |
45828027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 50052800 - 50052879
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgc-ccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||| |||||||||| ||||| |||| | | ||||||||| ||||||| |
|
|
| T |
50052800 |
aaaaccggcttgtgaggcgaggattgcaccccacttataaacacatggtcaggccatattttgtccgatgtgggactctt |
50052879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 1681756 - 1681710
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||||| |||||||||| |
|
|
| T |
1681756 |
acaaaaccggcttgtggggtgatgattacacccacttataaacacat |
1681710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 9264095 - 9264133
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9264095 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
9264133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 9264302 - 9264340
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9264302 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
9264340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 39078780 - 39078818
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39078780 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
39078818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 39956683 - 39956721
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39956683 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
39956721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 44573421 - 44573383
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
44573421 |
ctcatccttacaaaaccggcttgtagggtgaggagtgcc |
44573383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 49477422 - 49477384
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49477422 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
49477384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 49477629 - 49477591
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49477629 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
49477591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 50692418 - 50692380
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50692418 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
50692380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 50692621 - 50692583
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50692621 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
50692583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 50930753 - 50930707
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
50930753 |
acaaaaccgttttgtgaggtgaggattgcccccacttataaacacat |
50930707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 51338450 - 51338488
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51338450 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
51338488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 51642437 - 51642475
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51642437 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
51642475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 51642644 - 51642682
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51642644 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
51642682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 94
Target Start/End: Original strand, 19954278 - 19954335
Alignment:
| Q |
37 |
gcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| ||| ||||||| ||||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
19954278 |
gcccctacttataaacatattgtcagaccatctcctataagatgtgggactcttaaca |
19954335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 33640321 - 33640253
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||| ||||| ||||| ||||||| ||||||||||||||||||| | || ||||||| ||| ||||||| |
|
|
| T |
33640321 |
ttgtgaggtgaagattgtccccacttataaacacattgtcagacc-tctcttatccgacgtgtgactctt |
33640253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 34610612 - 34610559
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgc-ccccactcataaacacattgtcag |
62 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
34610612 |
acaaaaccgacttgtgaggtgaggattgccccccacttataaacatattgtcag |
34610559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 43781635 - 43781582
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||| |||||| |||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
43781635 |
tacaaaaccgacttgtgaagtgaggattgcctccacttataaactcattgtcag |
43781582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 46794090 - 46794034
Alignment:
| Q |
24 |
tggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
|||||||| |||||| || ||| ||||||||||||||||||||| || |||||||||| |
|
|
| T |
46794090 |
tggggtgatgattgctcc-acttataaacacattgtcagaccatctcttatccgatgt |
46794034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 2805414 - 2805342
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
|||||||| ||| || |||||| ||||||||| ||| ||||||||||||| ||||||| || |||||||||| |
|
|
| T |
2805414 |
acaaaaccaacttatgaggtgagaattgccccccacttataaacacattgttagaccatctcatatccgatgt |
2805342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 3975391 - 3975475
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||| | ||||| |||| ||||||| |||||||||||||||| || ||||||||||| | ||||||||||| |
|
|
| T |
3975391 |
acaaaatcggcttgagaggtgatgattatccccacttataaacacattgtcaggttatcacctatccgatgcgtgactcttaaca |
3975475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 94
Target Start/End: Complemental strand, 4008708 - 4008652
Alignment:
| Q |
38 |
cccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| | ||||||| |||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
4008708 |
cccccatttataaacatattgtcaggccatcacctatccgatgcgagactcttaaca |
4008652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 10758777 - 10758813
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattg |
37 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
10758777 |
ctcatccttacaaaaccggcttgtgaggtgagtattg |
10758813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 34992856 - 34992808
Alignment:
| Q |
47 |
ataaacacatt-gtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
34992856 |
ataaacacatttgtcagaccatcacctatccgatgtgggactcttaaca |
34992808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 56
Target Start/End: Complemental strand, 41915220 - 41915176
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
41915220 |
aaaactggtttgtgaggtgaggattgcccccacttataaacacat |
41915176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 45828297 - 45828217
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||| |||||||||| |||| |||| | | ||||||||| ||||||| |
|
|
| T |
45828297 |
acaaaacctgcttgtgaggtggagattgcccccacttataaacacatgttcaggccatcttttgtccgatgtgggactctt |
45828217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 1967 - 1882
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
1967 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaacag |
1882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 2202 - 2118
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
2202 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
2118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 101)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 10450052 - 10449967
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10450052 |
tacaaaaccggcttctgaggtgaggattgcccacacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca |
10449967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 11232462 - 11232547
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
11232462 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaacag |
11232547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5931982 - 5932066
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||| ||||| |||||| ||||||||||| |
|
|
| T |
5931982 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtactatctgatgtgggactcttaaca |
5932066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 11232227 - 11232311
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
11232227 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
11232311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 24532454 - 24532538
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||||||||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
24532454 |
acaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca |
24532538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 39052962 - 39053046
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
39052962 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
39053046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 7730001 - 7729912
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||| |||| || |||| |||||| ||||||| |
|
|
| T |
7730001 |
ctcatccttacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatggtcaggccatctcatatctgatgtgggactctt |
7729912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5590401 - 5590485
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
5590401 |
acaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactctgaaca |
5590485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 12317097 - 12317013
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| | |||| || ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
12317097 |
acaaaatcagcttatgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca |
12317013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35682814 - 35682898
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
35682814 |
acaaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca |
35682898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 5932217 - 5932294
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
5932217 |
acaaaacaggcttgtgaggtgaggcttgcccccacttataaacacattgttagaccatgtcctatccgatgtgggact |
5932294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 17469869 - 17469784
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
17469869 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacag |
17469784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 25325697 - 25325612
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||||| ||||||||||||| || ||||||||||||||||||| |||||||||||| |
|
|
| T |
25325697 |
acaaaactggcttgtgaggagaggattgcacccacttataaacacattgttaggccatgtcctatccgatgtgggactcttaacag |
25325612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 422250 - 422334
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||| |||||||||||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
422250 |
acaaaactggcttgtgaggtgaggattgcctccacttttaaacacattgtcagaccatctcctatccgatgtgggacttttaaca |
422334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 17477116 - 17477032
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
17477116 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
17477032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 18004129 - 18004213
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||| |||||||| ||||||||| || |||||| ||||||||||| |
|
|
| T |
18004129 |
acaaaaccgacttatggggtgaggattgcccccacttataaacatattgtcaggccatgtcctgtctgatgtgggactcttaaca |
18004213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 19256619 - 19256703
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
19256619 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
19256703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 39984865 - 39984782
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| ||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
39984865 |
acaaaactggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaatcgatgtgagactcttaac |
39984782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 42846638 - 42846725
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccc-ccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||| |||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
42846638 |
acaaaaccggcttgtgaggtgaggattgccctccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaacaga |
42846725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 19256853 - 19256938
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
19256853 |
acaaaacctgcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacag |
19256938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 28069401 - 28069474
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| |||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
28069401 |
ttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggactcttaaca |
28069474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 39960243 - 39960158
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||| ||||||| ||| |||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
39960243 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctcctatccgatgtgggactcttaaca |
39960158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 11 - 87
Target Start/End: Complemental strand, 8084177 - 8084101
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| ||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
8084177 |
caaaaccagcttgtgaggtgaggattgcccccacttataaatacattgtcagactatgtcctgtccgatgtgggact |
8084101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 15042703 - 15042787
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||| ||| | ||||| ||||||||||||| |||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
15042703 |
acaaaatcggtttgcgaggtgatgattgcccccacttataaacacattgtcaggccatgtcgtatccgatgtgggactcttaaca |
15042787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 22638212 - 22638292
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||| ||| ||| |||| || ||||||||||||||||||| |
|
|
| T |
22638212 |
acaaaaccggcttgtgtggtgaggattgcccctacttataaacactttgacaggccatctcttatccgatgtgagactctt |
22638292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 24075339 - 24075423
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| | |||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
24075339 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaagtgtcaggccaactcctaaccgatgtgggactcttaaca |
24075423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 34843168 - 34843084
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| ||||||| ||||| |||||| ||||| |||||||| ||||||||||| |
|
|
| T |
34843168 |
acaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattgttagaccaactcctaaccgatgtgggactcttaaca |
34843084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 37001515 - 37001435
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||| |||||||| ||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
37001515 |
acaaaaccggcttgtgatgtgaggattgtccccacttataaacactttgtcaggccatttcctgtccgatgtgagactctt |
37001435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 38447460 - 38447532
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| || |||||| |||| |
|
|
| T |
38447460 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatctcttatccgttgtg |
38447532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 9 - 95
Target Start/End: Original strand, 7267497 - 7267583
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||||||| ||||||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
7267497 |
tacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaagccaactcctaaccgatgtgtgactcttaacag |
7267583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 29907761 - 29907839
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||| |||||| ||||||||||| ||||||| |||||||||||||||||| || || ||||||||||| ||||||| |
|
|
| T |
29907761 |
aaaaccgacttgtgaggtgaggattgaccccacttataaacacattgtcagactatctcttatccgatgtgggactctt |
29907839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 4828344 - 4828264
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| ||||||| ||| ||||| |||||||| ||||||| |
|
|
| T |
4828344 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactctt |
4828264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 39743580 - 39743496
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
39743580 |
acaaaatcggcttgtgaggtgaggattgccccaacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
39743496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 69
Target Start/End: Complemental strand, 7669692 - 7669633
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgt |
69 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7669692 |
acaaaaccaacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgt |
7669633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 8929068 - 8928997
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| | |||||||||||||||| |||| || |||||||||| |
|
|
| T |
8929068 |
acaaaaccggcttgtgaggtgcggattgcccccagttataaacacattgtcaggccatctcatatccgatgt |
8928997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 20301548 - 20301501
Alignment:
| Q |
14 |
aaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20301548 |
aaccggcttgtggggtgaggattgcccccacttataaacacattgtca |
20301501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 21088180 - 21088133
Alignment:
| Q |
14 |
aaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21088180 |
aaccggcttgtggggtgaggattgcccccacttataaacacattgtca |
21088133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 39052587 - 39052654
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||| |||||| |||||| ||||||||||| |
|
|
| T |
39052587 |
ggtgaggattgcccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
39052654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Original strand, 42049720 - 42049766
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42049720 |
acaaaaccggcttgtggggtgaggattgcccccacttataaacacat |
42049766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 3157592 - 3157677
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||| ||||| |||||| ||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
3157592 |
acaaaactggcttgtgaggtgaggattgccccccacttataaatacattgccaggccatcacctatccgatgtgggactcttaaca |
3157677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 12688358 - 12688277
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||| |||||||||||||||| ||| | |||||| ||||| |||||||| |
|
|
| T |
12688358 |
acaaaactggcttgtgaggtaaggattgcccccacttataaacacattgtcaggtcatcttctatccaatgtgggactctta |
12688277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 21 - 82
Target Start/End: Original strand, 34236692 - 34236753
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
||||| |||||||||||| |||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
34236692 |
ttgtgaggtgaggattgctcccacttataaacacattgtcagaccatctcttatccgatgtg |
34236753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 36917472 - 36917557
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||| | |||||| ||||||||| |||||||| ||||| |||||||||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
36917472 |
acaaaactgacttgtgatgtgaggattacccccacttataaatacattgtcaggccattacctatctgatgtgagactcttaacag |
36917557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 12547149 - 12547066
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||| ||||| | |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
12547149 |
acaaaaccggcttgtgaggtgaagattgcccc-acttataaataaattgtcagaccaactcctaaccgatgtgggactcttaaca |
12547066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 20301312 - 20301228
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||| ||||||||||||||| |||| || ||||| ||||| |||||||||| |
|
|
| T |
20301312 |
acaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca |
20301228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 21087944 - 21087860
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||| ||||||||||||||| |||| || ||||| ||||| |||||||||| |
|
|
| T |
21087944 |
acaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca |
21087860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 93
Target Start/End: Original strand, 29099784 - 29099856
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||| ||||| ||||||| ||||| ||||||||||||||||||||| | |||| |||| ||||||||||||| |
|
|
| T |
29099784 |
ttgtgaggtgaagattgcctccacttataaacacattgtcagaccatcttctattcgatatgagactcttaac |
29099856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 3 - 54
Target Start/End: Original strand, 44931208 - 44931259
Alignment:
| Q |
3 |
catccttacaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||| |||||||| |
|
|
| T |
44931208 |
catccttacaaaaccggcttgtgaggcgaggattgcccccacttataaacac |
44931259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 3157368 - 3157441
Alignment:
| Q |
19 |
gcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||||||||||| ||| |||||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
3157368 |
gcttgtgaggtgaggattgccccccacttataaacacattgtcaggcca---cctatcccatgtgagactcttaaca |
3157441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 90
Target Start/End: Complemental strand, 5940110 - 5940029
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||| ||||||| ||||||||||| ||||| | ||||||||||||||| ||||| || |||||||||| ||||||| |
|
|
| T |
5940110 |
tacaaaacttgcttgtgaggtgaggattgtccccatttataaacacattgtcaaaccatctctcatccgatgtgggactctt |
5940029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 10884116 - 10884063
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgc-ccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
10884116 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcag |
10884063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 20515195 - 20515138
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
20515195 |
acaaaaccggcttgtgatgtgaggattgccccgacttataaacacattgtcaggccat |
20515138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 35385844 - 35385929
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattg-cccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||||| ||||||| ||| |||| | || | |||||||||||| ||||||||||| |
|
|
| T |
35385844 |
acaaaaccggcttatgaggtgaggattgccccccacttataaacatattatcaggctatcttctatccgatgtgggactcttaaca |
35385929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 54
Target Start/End: Complemental strand, 38475799 - 38475754
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
38475799 |
tacaaaaccggcttgtgaggtgaggattgcccccacttataaacac |
38475754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 4828119 - 4828039
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||||| ||||||| || ||||| |||||||| ||||||| |
|
|
| T |
4828119 |
acaaaaccggcttgtgaggtgaggattgtccccacttataaacaaattgtcatgtcaactcctaaccgatgtgggactctt |
4828039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 4873490 - 4873574
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| | |||||| |||||| ||| |||||||| |||| |||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
4873490 |
acaaaactgacttgtgaggtgagtattacccccactgataactgcattgtcagaccatctcttatccgatgtgggactcttaaca |
4873574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16050311 - 16050228
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || ||||||||||| || |||| ||||| | |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
16050311 |
acaaaaccggctt-tgaggtgaggattgtcctcacttataaataaattgtcaggccaactcctaaccgatgtgagactcttaaca |
16050228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 28213354 - 28213434
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||| |||||| |||||| | || ||||||| ||||| |||||||||||| || || |||||||||| |||||||| |
|
|
| T |
28213354 |
acaaaaccgacttgtgaggtgagaaatgtccccacttataaatacattgtcagactatctcttatccgatgtaagactctt |
28213434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 34842729 - 34842645
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| | | || ||||||||||||||||||| ||||||| |||||||| ||| ||||| | |||||| ||||||||||| |
|
|
| T |
34842729 |
acaaaaccgacctatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactgatgtgggactcttaaca |
34842645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 37868105 - 37868149
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
37868105 |
acaaaaccggcttgtgtggtgaggattgcccccactaataaacac |
37868149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 37868381 - 37868425
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
37868381 |
acaaaaccggcttgtgaggtgaggattgcccccactaataaacac |
37868425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 41790710 - 41790658
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
||||||||||||| || ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
41790710 |
acaaaaccggcttatgaggtgaggattgtccccacttataaacacattgtcag |
41790658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 3157051 - 3157126
Alignment:
| Q |
20 |
cttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
3157051 |
cttgtgaggtgaggattgccccccacttataaacacattgttgggccatcatctatccgatgtgagactcttaaca |
3157126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 26800545 - 26800624
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactct |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| ||| ||| |||| ||| | ||| |||||||| |||||| |
|
|
| T |
26800545 |
acaaaaccggcttgtgtggtgaggattgcccccacttatagacaaattatcaggccaacttctaaccgatgtgggactct |
26800624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 80
Target Start/End: Original strand, 20094827 - 20094897
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatg |
80 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||| ||||||| | ||||||||| |
|
|
| T |
20094827 |
acaaaaccggcttgtaaggtgaggattgcccccacatataaacatattgtaagaccatcttttatccgatg |
20094897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 30966098 - 30966148
Alignment:
| Q |
8 |
ttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattg |
58 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
30966098 |
ttacaaaaccggcttgtaaggtgaggactgcccccacttataaacacattg |
30966148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 31197888 - 31197814
Alignment:
| Q |
20 |
cttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||||| | ||||| | |||||||||||||| |||| |||||| |||||| ||||||||||| |
|
|
| T |
31197888 |
cttgtgaggtgaggattgtctccacttacaaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
31197814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 12688123 - 12688070
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcaga |
63 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
12688123 |
acaaaaccggcttgtgaggtggggattgccctcacttataaacacattatcaga |
12688070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 20702848 - 20702763
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||| ||||||| | |||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
20702848 |
acaaaaccggcttatgagatgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcttaaca |
20702763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 31197667 - 31197582
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||| || |||||| ||| ||| ||| ||||||||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
31197667 |
tacaaaaccgacttttgaggtgagaattacccttacttataaacacattgtcagaccatcacctatctgatgtaggactcttaaca |
31197582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 37001277 - 37001228
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgt |
59 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
37001277 |
acaaaaccggcttgtgaggtgaggattgcccccacctataaacactttgt |
37001228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 4873724 - 4873795
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||||||||||||| |||||| |||| || |||| |||||||||||||||| ||| || ||||||||||| |
|
|
| T |
4873724 |
acaaaaccggcttgtgaggtgagaattg-ccacacttataaacacattgtcaggtcatctcttatccgatgtg |
4873795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 8084413 - 8084329
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| || ||||| ||||||| || |||||||| ||||| ||||||| || ||||||| | | ||||||| ||||||||||| |
|
|
| T |
8084413 |
acaaaactggtttgtgaggtgaggtttacccccacttataaatacattgttaggccatgtcttgttcgatgtgggactcttaaca |
8084329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 8716165 - 8716085
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||| |||||| || ||||||||||||| |||| |||||||||||| ||||||| || |||||||| ||||| |||| |
|
|
| T |
8716165 |
acaaaatcggcttatgaggtgaggattgccttcacttttaaacacattgtgagaccatctcttatccgatatgagattctt |
8716085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16050080 - 16049996
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| | |||||| ||||||||||||| |||| ||||||| ||| |||| ||| ||||| ||||||||||||| |||||| |
|
|
| T |
16050080 |
acaaaactgacttgtgaggtgaggattgccttcacttataaacaaattatcaggccaactcctaaccgatgtgagacttttaaca |
16049996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 28213145 - 28213220
Alignment:
| Q |
18 |
ggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||||||||| | ||| ||||||||||||||||||||| || |||| ||| | ||||||||||| |
|
|
| T |
28213145 |
ggcttgtgaggtgaggattgccgc-acttataaacacattgtcagaccatctcatatcttatgcgggactcttaaca |
28213220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 30201557 - 30201637
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||| |||||| |||| || |||| || ||||||||||| ||||||| |
|
|
| T |
30201557 |
acaaaaccggcttgtgaggtgaagattgaccccacttataaacttattgccatgccatctcttatccgatgtgggactctt |
30201637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 34653201 - 34653118
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| || |||||| || | ||| ||||||| ||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
34653201 |
acaaaaccggcttgtgatgttaggattacctc-acttataaacaaattgtcagatcaactcctaaccgatgtgagactcttaaca |
34653118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 37867865 - 37867909
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
37867865 |
acaaaaccggcttgtgaggtgagaattgcccccactaataaacac |
37867909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 6559482 - 6559525
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaaca |
53 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
6559482 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaaca |
6559525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 94
Target Start/End: Original strand, 20094614 - 20094677
Alignment:
| Q |
31 |
aggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||| |||||||||||||||| |||| | |||| ||||||| ||||||||||| |
|
|
| T |
20094614 |
aggattgtccccacatataaacacattgtcaggccatcttctattcgatgtgggactcttaaca |
20094677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 53
Target Start/End: Original strand, 45031390 - 45031437
Alignment:
| Q |
6 |
ccttacaaaaccggcttgtggggtgaggattgcccccactcataaaca |
53 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
45031390 |
ccttacaaaaccggcttgtaaggtgaggattgccccgacttataaaca |
45031437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 8466759 - 8466837
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||| |||||||| ||| |||| || ||||||||||||||||||| |
|
|
| T |
8466759 |
aaaaccagcttgtgaggtgaggattgtccccacttataaacactcgttcatgccatctcttatccgatgtgagactctt |
8466837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 8559676 - 8559638
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8559676 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
8559638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 10989043 - 10989081
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10989043 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
10989081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 10989250 - 10989288
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10989250 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
10989288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 15011038 - 15011076
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15011038 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
15011076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 16454644 - 16454682
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16454644 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
16454682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Original strand, 37868616 - 37868662
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
37868616 |
acaaaaccagcttgtgaggtgaggattgcccccattaataaacacat |
37868662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 43599406 - 43599368
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43599406 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
43599368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Complemental strand, 7669447 - 7669386
Alignment:
| Q |
33 |
gattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||||| | ||||||||||| | ||||||||| |
|
|
| T |
7669447 |
gattgcccccacttataaacacgttgtcaaaccatcttctatccgatgtagggctcttaaca |
7669386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 82
Target Start/End: Original strand, 8466532 - 8466593
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
||||| |||||||||| |||||||| |||||||| | ||||||||| || ||||||||||| |
|
|
| T |
8466532 |
ttgtgaggtgaggatttcccccacttataaacacttgttcagaccatctcttatccgatgtg |
8466593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 27439580 - 27439637
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
|||||||| ||||||| || |||||||| ||| ||| |||||||||||||||| |||| |
|
|
| T |
27439580 |
acaaaaccagcttgtgaggcgaggattgaccctacttataaacacattgtcaggccat |
27439637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 36037285 - 36037252
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgagga |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
36037285 |
ctcatccttacaaaaccggcttgtgaggtgagga |
36037252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 5496821 - 5496777
Alignment:
| Q |
50 |
aacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
5496821 |
aacatattgtcagaccatctcatatccgatgtgaggctcttaaca |
5496777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 5675767 - 5675847
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||| | ||||||| |||||| |||| | | ||| ||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
5675767 |
acaaaatcagcttgtgaggtgagaattgtctctacttataaacacattgtcagaccatcatctatccgatgtaggactctt |
5675847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 6463243 - 6463163
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||| ||| ||| |||| |||||||| ||||||| |||||||| | | || ||||||||||||||||||| |
|
|
| T |
6463243 |
acaaaaccggctcgtgacatgaagattacccccacttataaacaaattgtcaggtcttctcatatccgatgtgagactctt |
6463163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 27205015 - 27204975
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataa |
50 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
27205015 |
acaaaaccggcttatgaggtgaggattgcccccacttataa |
27204975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 27205113 - 27205073
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataa |
50 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
27205113 |
acaaaaccggcttatgaggtgaggattgcccccacttataa |
27205073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 27205211 - 27205171
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataa |
50 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
27205211 |
acaaaaccggcttatgaggtgaggattgcccccacttataa |
27205171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 42584725 - 42584673
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
42584725 |
acaaaatcggctggtaaggtgagtattgcccccacttataaacacattgtcag |
42584673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 91)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 2859660 - 2859745
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2859660 |
acaaaaccggcttgtgaggtgaggattacccccactaataaacacattgtcagaccatcacctatccgatgtgagactcttaacag |
2859745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25145518 - 25145602
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25145518 |
acaaaaccgacttgtgaggtgaggattgcccccactaataaacacattgtcagaccatcacctatccgatgtgagactcttaaca |
25145602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 96
Target Start/End: Original strand, 4113039 - 4113125
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||| |||||||||| |||| |||||||| |
|
|
| T |
4113039 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcccatccgatgtgggacttttaacaga |
4113125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 20208576 - 20208644
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20208576 |
ggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaacag |
20208644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 41035860 - 41035944
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
41035860 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacatattggcaggccatgtcctatccgacgtgagactcttaaca |
41035944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17452861 - 17452945
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||| |||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
17452861 |
acaaaaccggcttgtgaggtgaagattgcccccacttataaatacattgtcaggccatgtcttatccgatgtgggactcttaaca |
17452945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 25713444 - 25713360
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
25713444 |
acaaaactggcttgtgaggtgacgattgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca |
25713360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 35772315 - 35772231
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||||| |||||||||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
35772315 |
acaaaaccggcttctgaggtaaggattgcccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca |
35772231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 11 - 95
Target Start/End: Complemental strand, 43409856 - 43409773
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| |||||| |||||||| ||| ||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43409856 |
caaaaccggcttgtgaggtgagaattgcccc-acttataaatacattgtcagaccatgttctatccgatgtgagactcttaacag |
43409773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 52961631 - 52961549
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| || |||||||||||||| |||| ||||||||||||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
52961631 |
aaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctcctatccgatgtgggacacttaaca |
52961549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 3169817 - 3169733
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
3169817 |
acaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
3169733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25145753 - 25145837
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| ||||| |||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
25145753 |
acaaatccggcttgtgaggtgaggattgcccccactaataaatacattgtcaggtcatcacctatccgatgtgagactcttaaca |
25145837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 51589043 - 51588959
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
51589043 |
acaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
51588959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 51589277 - 51589193
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
51589277 |
acaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
51589193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 52650804 - 52650888
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||||||| | |||| |||||||||||||| ||||| ||||| |
|
|
| T |
52650804 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtccggccatctcctatccgatgtgggactcctaaca |
52650888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 40079203 - 40079132
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
40079203 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatctcctatccgatgt |
40079132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 4112795 - 4112888
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||| ||||| ||| |||||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
4112795 |
ctcatcctta-aaaaccggtttgtgaggtgaggatttccccccacttataaacacattgtcaggccatgtcccatccgatgtgggactcttaaca |
4112888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 2859429 - 2859506
Alignment:
| Q |
14 |
aaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
2859429 |
aaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactctta |
2859506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 93
Target Start/End: Complemental strand, 17412393 - 17412304
Alignment:
| Q |
4 |
atccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||||||||||||| || | |||| |||||| ||||||| ||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
17412393 |
atccttacaaaaccggtttacgaggtgcggattgtccccacttataaacacattatcagacaatctcctatccgatgtgagactcttaac |
17412304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 17452712 - 17452789
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||| |||| |||||| |||| |
|
|
| T |
17452712 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcttatctgatgtgggact |
17452789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 26176959 - 26176874
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||| || || |||||||||||||| |||| |||| ||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
26176959 |
acaaaaccggtttttgaggtgaggattgccctcacttataagcacattgtcaggccatgtcctgtccgatgtgggactcttaacag |
26176874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 369695 - 369603
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| |||||| || |||| |||||||| |||||||||| |
|
|
| T |
369695 |
ctcatccttacaaaaccatcttgtaaggtgaggattgcccccacttataaacacattttcagactatctcctgcccgatgtgggactcttaac |
369603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 856032 - 855948
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||||| |||||||||||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
856032 |
acaaaaccagcttgtgaggtgaggattgtccccacgtataaacacattgtcaggccatgtcctatccggtgtggaactcttaaca |
855948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 15986366 - 15986450
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||| |||||||||||||||| | || ||||||||||||| ||||||||||| |
|
|
| T |
15986366 |
acaataccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggctatctcctatccgatgtaggactcttaaca |
15986450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 4112575 - 4112657
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||| ||| ||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
4112575 |
aaaatcggcttgtgaggtgatgattgcccctacttataaacacattgtcatgccatgtcctgtccgatgtgggactcttaaca |
4112657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 8870732 - 8870806
Alignment:
| Q |
20 |
cttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| ||||| || |||||||||| ||||||||||| |
|
|
| T |
8870732 |
cttgtgaggtgaggattgcccccacttataaacacattgtcacaccatcaccgatccgatgtgggactcttaaca |
8870806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 96
Target Start/End: Complemental strand, 38080655 - 38080570
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| | | |||||||||||||||| |||| ||| |||||||||| ||||||||||||| |
|
|
| T |
38080655 |
acaaaactggcttgtgaggtgaggattgccccaatt-ataaacacattgtcaggccatctcccatccgatgtgggactcttaacaga |
38080570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 26173489 - 26173574
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| || |||| |||||| |||||||||||| |
|
|
| T |
26173489 |
acaaaaccggcttacaaggtgagaattgcccccacttataaacacattgtcagaccatctcatatctgatgtgggactcttaacag |
26173574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 4098196 - 4098280
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| | |||||||||||||||| |||||||||| ||||||| || || ||| ||||||||||||||||||| |
|
|
| T |
4098196 |
acaaaaccggtttgtgaagagaggattgcccccacttataaacacatcgtcagacgatctcatattcgatgtgagactcttaaca |
4098280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 12244995 - 12245079
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||| ||||||| ||||| |||||| ||||||||||| |
|
|
| T |
12244995 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgccagaccaactcctaatcgatgtaggactcttaaca |
12245079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 16163218 - 16163134
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
16163218 |
acaaaaccggattgtgaggtgaagattgcccccacttataaacacattgtcaagtcatcacctatccgatgtgggactcttaaca |
16163134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 26177194 - 26177110
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| || || || ||||||||||||||||||| |||||||| ||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
26177194 |
acaaaactggtttttgaggtgaggattgcccccacttataaacacgttgtcaggtcatgtcctgtccgatgtgggactcttaaca |
26177110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 26865391 - 26865475
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||| |||||||||| |||||| | ||||||||| ||| ||||||| |
|
|
| T |
26865391 |
acaaaaccggcttgtgaggtggggattgcccccacttataaatacattgtcaggtcatgtcttgtccgatgtgggacacttaaca |
26865475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 28408075 - 28408159
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||| ||||||| |||||||||||| | ||| |||||||| ||||||||||| |
|
|
| T |
28408075 |
acaaaaccggcttgtgaggtaaggattgtccccacttataaacaaattgtcagaccaacttctaaccgatgtgggactcttaaca |
28408159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 35892342 - 35892258
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||| ||||||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
35892342 |
acaaaaccgggttgtgaggtgagtattgcccccacttataaatacattgtcagaccatcttatatctgatgtgggactcttaaca |
35892258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 38668411 - 38668327
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||||||| ||||||||||||||| ||||| | ||||||||||| ||||||||||| |
|
|
| T |
38668411 |
acaaaaccgacttgtaaggtgatgattgcccccacttataaacacattgtcaaaccatcacatatccgatgtgggactcttaaca |
38668327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 38733433 - 38733349
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| | || |||||||||||||| |||| ||||||| ||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
38733433 |
acaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatcacatatccgatgtgggactcttaaca |
38733349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 42586480 - 42586555
Alignment:
| Q |
18 |
ggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||| |||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
42586480 |
ggcttgtgaggtgaggattgcccc-acttatatacacattgtcaggccatctcttatccgatgtgagactcttaaca |
42586555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 39808516 - 39808434
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||| ||||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
39808516 |
acaaaaccggtttg-ggggtgaggattgtccccacttataaacacattgtcagaccatcacatatccaatgtgggactcttaac |
39808434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 51459880 - 51459947
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || |||| ||||||||||||| ||||||||||| |
|
|
| T |
51459880 |
ggtgaggattgcccccacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca |
51459947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 3170052 - 3169967
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaa-cacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||| ||||| || |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
3170052 |
acaaaaccggcttgtgaggtaaggattgccctcacttataaaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
3169967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 29 - 90
Target Start/End: Complemental strand, 17468376 - 17468315
Alignment:
| Q |
29 |
tgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
17468376 |
tgaggattgcccccacttataaacatattgtcagaccatctcttatccgatgtgggactctt |
17468315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 63
Target Start/End: Original strand, 26173257 - 26173310
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcaga |
63 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
26173257 |
acaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaga |
26173310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 4098435 - 4098519
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| ||||||||||| ||| ||||| | ||||||||||| ||||||||||| |
|
|
| T |
4098435 |
acaaaaccaacttgtaaggtgaggattgcccccacttataaacacattatcaaaccatctattatccgatgtgcgactcttaaca |
4098519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 14 - 90
Target Start/End: Original strand, 7826068 - 7826144
Alignment:
| Q |
14 |
aaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||| ||||||||||||||||||||| | ||| ||||||| ||||||| |
|
|
| T |
7826068 |
aaccggcttgtgaggtaaggattgtccccacttataaacacattgtcagaccatcttttattcgatgtgggactctt |
7826144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 26603479 - 26603395
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || ||||||||||| || | ||||||| ||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
26603479 |
acaaaaccggcttatgaggtgaggattgtaccattttataaacatattgtcagaccatctcctattcgatgtgagactcttaaca |
26603395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 39348385 - 39348457
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |||||||| |||||| |||| ||||||| |||||| |
|
|
| T |
39348385 |
acaaaaccggtttgtgaggtgaggattgcccccacttataaacacgttgtcaagccatctcctatctgatgtg |
39348457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 93
Target Start/End: Original strand, 25137336 - 25137419
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||||||||| || |||||||||||||| ||| ||||||| |||||||| ||| ||||| |||||||| |||||||||| |
|
|
| T |
25137336 |
acaaaaccggcttatgaggtgaggattgcccatacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaac |
25137419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 30369876 - 30369802
Alignment:
| Q |
20 |
cttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||||| |||||| |||||| || ||||||||||| |||||||||| |
|
|
| T |
30369876 |
cttgtgaggtgaggattgcccctacttataaacatattgtcggaccatctcatatccgatgtggaactcttaaca |
30369802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 90
Target Start/End: Original strand, 39348171 - 39348232
Alignment:
| Q |
29 |
tgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| | || |||||||||||||| ||||||| |
|
|
| T |
39348171 |
tgaggattgcctccacttataaacacattgtcaggctatctcctatccgatgtgggactctt |
39348232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 52907435 - 52907358
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||| ||| ||||| | ||||||||||| |||| |
|
|
| T |
52907435 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaaaccatattttatccgatgtgggact |
52907358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 11924972 - 11924888
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| |||| |||||| | | |||||||| ||||||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
11924972 |
acaaaaccggtttgtaaggtgagaaatacccccacttataaacatattgtcagaccatcacctatccgatgtgtaactcttaaca |
11924888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 27 - 95
Target Start/End: Complemental strand, 13386282 - 13386214
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||| |||| ||| ||| |||||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
13386282 |
ggtgaggattaccccaacttatatacacattgccaggccatgtcctatccgatgtggaactcttaacag |
13386214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 35303490 - 35303558
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||| |||| | ||||| ||||| ||||||||||| ||||| |||||||||||| |||||||||||| |
|
|
| T |
35303490 |
ggtgagaattgtctccacttataaatacattgtcagatcatgttctatccgatgtgggactcttaacag |
35303558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 66
Target Start/End: Complemental strand, 51589857 - 51589801
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagacca |
66 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
51589857 |
acaaaatcggcttgtgaggtgaggattgccctcacttataaacaaattgtcagacca |
51589801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 33156983 - 33156936
Alignment:
| Q |
47 |
ataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33156983 |
ataaacacattgtcagaccatctcctatccgatgtggaactcttaaca |
33156936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 16162984 - 16162902
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||| ||| || || ||||||| ||| ||||||| | |||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
16162984 |
acaaaatcggtttatgaggtgaggtttgtccccacttaaaaacacattgtcaggccatcacatatccgatgtgagactcttaa |
16162902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 27413631 - 27413549
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||| ||||||| |||||||| |||| ||||| ||||||| |||| |||||| |
|
|
| T |
27413631 |
aaaaccgatttgtgaggtgaggattgcctccacttataaacatattgtcaggccatcacctatgcgatgtgggacttttaaca |
27413549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 56
Target Start/End: Original strand, 31004470 - 31004516
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
31004470 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacacat |
31004516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 31181548 - 31181618
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |||||||||| |||| |||| || ||||| ||||| |
|
|
| T |
31181548 |
aaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaggccatctcttatccaatgtg |
31181618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 54
Target Start/End: Original strand, 7465681 - 7465722
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
7465681 |
aaaccggcttgtgaggtgaggattgcccccacttataaacac |
7465722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 51590089 - 51590007
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| | |||| ||||||| |||||||||| | ||||| | |||||| ||||||||||| |
|
|
| T |
51590089 |
acaaaaccggcttgtgaggtgaggattg--ctcacttataaacaaattgtcagacaaactcctaactgatgtgggactcttaaca |
51590007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 4000320 - 4000245
Alignment:
| Q |
18 |
ggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||| |||| |||||| ||||||||||||||||||| | ||| |||| ||||||||||||||||| |
|
|
| T |
4000320 |
ggcttgtaaggtgagaattgttcccacttataaacacattgtcagaccttatcc-atccaatgtgagactcttaaca |
4000245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 70
Target Start/End: Original strand, 8870943 - 8871003
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtc |
70 |
Q |
| |
|
|||||| |||||| || |||||| |||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
8870943 |
acaaaaacggcttatgaggtgagaattgccccaacttataaacacattgtcagatcatgtc |
8871003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 17402763 - 17402707
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatg |
68 |
Q |
| |
|
|||||||| || || ||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
17402763 |
aaaaccggattttgaggtgaggattgcccccacttataaacaaattgtcaggccatg |
17402707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 25255362 - 25255279
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| |||| | |||| |||||||||||| |||||| || ||| ||||||||||||||||||| |
|
|
| T |
25255362 |
acaaaaccggcttgtgaggtgagaattgtcatcactt-taaacacattgtttgaccatctcttattcgatgtgagactcttaaca |
25255279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 51459738 - 51459822
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||| | || |||||||||||||| ||||||||||||| || | || |||||||||| || ||||||||||| |
|
|
| T |
51459738 |
acaaaaccagcttgtaagatgcggattgcccccacttataaacacattgttaggctatcacctatccgatatgggactcttaaca |
51459822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 51460131 - 51460199
Alignment:
| Q |
27 |
ggtgaggattgcccc-cactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||| || |||| ||||||||||||| ||||||||||| |
|
|
| T |
51460131 |
ggtgaggattaccccacacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca |
51460199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 7652332 - 7652285
Alignment:
| Q |
47 |
ataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
7652332 |
ataaacacattgtcagaccatcttttatccgatgtaagactcttaaca |
7652285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 12376461 - 12376516
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||| ||||||||| |||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
12376461 |
ctcatcctaacaaaaccgacttgtgaagtgaagattgcccccacttataaacacat |
12376516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 27 - 94
Target Start/End: Complemental strand, 17402616 - 17402549
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| |||||||| |||| |||||| ||||||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
17402616 |
ggtgaagattgcccgcacttttaaacaaattgtcagaccatcacctatccgatgtgggactcataaca |
17402549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 32783323 - 32783397
Alignment:
| Q |
19 |
gcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| | ||| |||||||||| || |||||||||| |||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
32783323 |
gcttgtgagatgaagattgcccccgcttataaacacat-gtcaaaccatctattatccgatgtgagactcttaaca |
32783397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 26366841 - 26366879
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26366841 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
26366879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 29272916 - 29272954
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29272916 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
29272954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 29273075 - 29273113
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29273075 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
29273113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 29273234 - 29273272
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29273234 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
29273272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 32952120 - 32952038
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||| || ||||||| | ||||| ||||||||||||||| |||| |||||||| ||||| || |||||||| |
|
|
| T |
32952120 |
aaaaccgacttgtgagggaaggattggctccacttataaacacattgtcaaaccaactcctatccaatgtgggattcttaaca |
32952038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 39649093 - 39649131
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39649093 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
39649131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Original strand, 40316083 - 40316129
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||||||||||| || ||||||||||| ||||||| |||||||||| |
|
|
| T |
40316083 |
acaaaaccggcttatgaggtgaggattgaccccacttataaacacat |
40316129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 40524701 - 40524755
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||| || ||| |||||| |
|
|
| T |
40524701 |
ggtgaagattgcccccacttataaacacactgtcagaccatctcatattcgatgt |
40524755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 43361561 - 43361599
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43361561 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
43361599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 52846858 - 52846896
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52846858 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
52846896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 7307772 - 7307723
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgt |
59 |
Q |
| |
|
||||||||| |||||| |||||| |||||| ||||| ||||||||||||| |
|
|
| T |
7307772 |
acaaaaccgacttgtgaggtgagaattgcctccacttataaacacattgt |
7307723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 63
Target Start/End: Original strand, 26347001 - 26347054
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcaga |
63 |
Q |
| |
|
||||||| |||||||| ||||||||||| | ||||| |||||||||| |||||| |
|
|
| T |
26347001 |
acaaaacgggcttgtgaggtgaggattgtctccacttataaacacatcgtcaga |
26347054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 90
Target Start/End: Original strand, 34264742 - 34264823
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||| | |||||| | || ||||| ||||||| ||||||||||||||||||| | ||||||| ||||| ||||||| |
|
|
| T |
34264742 |
tacaaaactgacttgtgagatgtggattatccccacttataaacacattgtcagaccgtctcctatctcatgtgtgactctt |
34264823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 43361766 - 43361803
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgc |
38 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43361766 |
ctcatccttacaaaaccggcttgtaaggtgaggattgc |
43361803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 43480433 - 43480380
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| | |||||||| ||||||| |
|
|
| T |
43480433 |
ctcatccttaaaaaaccggcttgtgaggtgaggactacccccacttgtaaacac |
43480380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 48558330 - 48558367
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgc |
38 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48558330 |
ctcatccttacaaaaccggcttgtaaggtgaggattgc |
48558367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 29898963 - 29898919
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||| |||||||| |
|
|
| T |
29898963 |
acaaaaccggcttgtgtggtgagaattgccctcacttataaacac |
29898919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 42
Target Start/End: Original strand, 31432263 - 31432295
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc |
42 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
31432263 |
acaaaaccggcttgtgaggtgaggattgccccc |
31432295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 38733202 - 38733119
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| | |||| |||| ||| ||| ||||||||||||||||||||| | ||| ||||||| |||||||||| |
|
|
| T |
38733202 |
acaaaaccgacttgtgagatgagaattgtccc-acttataaacacattgtcagaccatcacatattcgatgtggaactcttaaca |
38733119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 78)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 4868610 - 4868694
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
4868610 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
4868694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 25065127 - 25065209
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25065127 |
acaaaaccggcttgtgaggtgaggattgcccctacttataaacatattgtcagaccatgtcctatccgatgtgggactcttaa |
25065209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 9705071 - 9704986
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9705071 |
acaaaaccgacttgtgaggtgatgattgcccccacttataaacacattgtcaggctatgtcctatccgatgtgagactcttaacag |
9704986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 13353252 - 13353167
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
13353252 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag |
13353167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 4868846 - 4868930
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||| ||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
4868846 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccaggccatgtcctgtccgatgtgggactcttaaca |
4868930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 9705305 - 9705221
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| ||||||||||| |
|
|
| T |
9705305 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgttaagccatgtcctatccgatgtgggactcttaaca |
9705221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 12330324 - 12330407
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12330324 |
acaaaaccggcttgtgagatgaggattgcccc-acttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
12330407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17147693 - 17147777
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17147693 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
17147777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 33796377 - 33796293
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
33796377 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
33796293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 79
Target Start/End: Original strand, 12330212 - 12330281
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgat |
79 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12330212 |
acaaaaccggcttgtgaggtgagggttgcccccacttataaacacattgtcagaccatgtcctatccgat |
12330281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 24554168 - 24554084
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||| | ||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
24554168 |
acaaaaccggcttgtgaggtgaagattgcccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca |
24554084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 6542976 - 6543061
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||| ||||||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
6542976 |
acaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttatccgatgtggaactcttaacag |
6543061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 6400653 - 6400737
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||| |||||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
6400653 |
acaaaaccgacttgtgatgtgaggattgcctccacttataaacacattgtcaggccatgtcatgtccgatgtgagactcttaaca |
6400737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 6400879 - 6400963
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| ||||||| |||||||| ||||||| | ||||||||| ||||||||||| |
|
|
| T |
6400879 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacatattgtcaggccatgtcatgtccgatgtgggactcttaaca |
6400963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 33494590 - 33494506
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| ||| ||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
33494590 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacatattttcaagccatctcctatccgatgtgggactcttaaca |
33494506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 6542741 - 6542825
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||| | | ||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6542741 |
tacaaaaccggtttgtgaggtgatgattgcccc-atttataaacagattgtcagaccatctcctatccgatgtgagactcttaaca |
6542825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 27772765 - 27772680
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| || ||||||||| |
|
|
| T |
27772765 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggaatcttaacag |
27772680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 3680297 - 3680213
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||| ||||| ||||||||||||| ||||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
3680297 |
acaaaaccaacttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacatatccgatgtgggactcttaaca |
3680213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 21690773 - 21690689
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
21690773 |
acaaaatcggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaaatcctaaccgatgtgggactcttaaca |
21690689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 27656509 - 27656425
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
27656509 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27656425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 27772997 - 27772913
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
27772997 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27772913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 30256629 - 30256545
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| | ||||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
30256629 |
acaaaaccggtttgtgagttgaggattgcccccagttataaacacattgtcaaaccatgtattgtccgatgtgagactcttaaca |
30256545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 15102955 - 15103041
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||| || |||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
15102955 |
ctcatccttacaaaaccggcctgtgaagtgagaattgcccccgcttataaacacattgtcaggtcatcacctatccgatgtgagact |
15103041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 6054455 - 6054370
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||||| ||||| || |||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
6054455 |
tacaaaatcggtttgtgaggtgaggattgcccccacttataaataccttgtcagaccatctcttatccgatgttggactcttaaca |
6054370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 12199838 - 12199919
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
||||||| | |||||| ||||| ||||||||||||| ||||||| ||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
12199838 |
acaaaacggacttgtgaggtgatgattgcccccacttataaacatattgtcagaccatatcttatccgatgtgggactctta |
12199919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 27653268 - 27653183
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||| |||||| |||||||||| |||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
27653268 |
acaaaaccgacttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacag |
27653183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 2753309 - 2753225
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| |||||||||| |||||||| ||||||||||||||||| ||| || ||||||||| ||||||||||| |
|
|
| T |
2753309 |
acaaaaccgccttgtgaggtgaggattacccccacttataaacacattgtcagatcatcatctttccgatgtgggactcttaaca |
2753225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 8026440 - 8026356
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| || || |||| ||| ||||||||||| |
|
|
| T |
8026440 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcataaccgacgtgggactcttaaca |
8026356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 8566992 - 8567075
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||| ||| ||||||||||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
8566992 |
acaaaaccggtttgtgaggtgaggattgtccc-acttataaacacattgtcagaccatcacctatccgaggtgggactcttaaca |
8567075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 11085632 - 11085548
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| ||||||| |||||| | |||| ||||| ||||||||||||| |||||| |
|
|
| T |
11085632 |
acaaaaccggcttgtgaagtgagaattgcccccacttataaacatattgtcgggccatctcctacccgatgtgagactattaaca |
11085548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 12329977 - 12330061
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| | ||||||| ||||||||||||||||||| ||||||||||||| | | ||| || ||||||||||| ||||||||||| |
|
|
| T |
12329977 |
acaaaatcagcttgtgaggtgaggattgcccccacttataaacacattgttatatcatatcttatccgatgtgggactcttaaca |
12330061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 19713003 - 19712919
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||| |||||||| ||| ||||| |||||||| |||||||||| |
|
|
| T |
19713003 |
acaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
19712919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 30256863 - 30256782
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||||| |||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
30256863 |
acaaaaccggcttgtgaggtgaggattg-ccccacttataaacatattgtcaggtcatcacctatccgatgtgggactcttaa |
30256782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 30505798 - 30505704
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactc-ataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||||| |||||| || ||||||||||| ||||||| | ||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
30505798 |
ctcatccatacaaaatcggcttatgaggtgaggattgtccccactttacaaacacattgtcagaccatcttatatccgatgtgggactcttaaca |
30505704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 11721956 - 11721875
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||| ||||||| ||||| |||||| ||||| | ||| ||||||||||| |
|
|
| T |
11721956 |
acaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgttagaccaactcctaactgatatgagactctta |
11721875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 19639149 - 19639230
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||| ||||||||||| ||||||| |||||||||||||||| |||| || ||||| ||||| || |||||||| |
|
|
| T |
19639149 |
aaaccggtttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcttatcctatgtgggattcttaaca |
19639230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 15081941 - 15082025
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | | ||||||||||||||| |||||| |||||||| |||| ||||| ||| |||| ||||||||||| |
|
|
| T |
15081941 |
acaaaaccggcttgtgagttaaggattgcccccacttgtaaacatattgtcagtccatctcctaaccgttgtgggactcttaaca |
15082025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 15600987 - 15600903
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||| ||||||| ||| |||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
15600987 |
acaaaactgacttgtgaagtgaggattgcccccacttataaacaaattatcagaccaactcctaaccgatgtgggactcttaaca |
15600903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 28867990 - 28868074
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| | |||||||| || || || |||||||| ||||||||||| |
|
|
| T |
28867990 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaataaattgtcaggtcaactcgtaaccgatgtgggactcttaaca |
28868074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 30505567 - 30505470
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcata----aacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| ||||| | || || |||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
30505567 |
ctcatccttacaaaaccgacttgttaggtgaggattgtccccattaattttataaaacattgtcaggccatctcctatccgatgtgagactcttaaca |
30505470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 7638640 - 7638707
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||| ||| ||||||| || ||||||||||||||| |
|
|
| T |
7638640 |
ggtgaggattgcccccacttataaacacattatcaggtcatctcctatctgacgtgagactcttaaca |
7638707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 33494824 - 33494741
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgc-ccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||| ||||| | ||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33494824 |
aaaaccggcttgtgaggtgaggaataatccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca |
33494741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 4906855 - 4906773
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| |||||||| | |||||||||||| |||| |||||||||||||| ||| || || ||||||||||| |||||||||| |
|
|
| T |
4906855 |
aaaactggcttgtgagatgaggattgccctcacttataaacacattgtccgacaatctcttatccgatgtggaactcttaaca |
4906773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 6369526 - 6369429
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtgg--ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
||||||||||||||| | |||||| ||||||||||||||||||| ||||||||||||| ||| ||| ||| ||| ||||| ||||||||||||| |
|
|
| T |
6369526 |
ctcatccttacaaaatcagcttgtataaggtgaggattgcccccacttataaacacattgttagatcatcacctgtccaatgtgggactcttaacaga |
6369429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 7915902 - 7915817
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| ||| |||||||||||||||| ||| | |||||| |||| ||||||||||| |
|
|
| T |
7915902 |
acaaaatcggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccaacttctatccaatgttggactcttaaca |
7915817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 30849435 - 30849516
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||| |||| ||||||| || | ||| || |||||||||||||||||||| |
|
|
| T |
30849435 |
acaaaaccggcttgcgatgtgaggattgctcccacttataagcacattgccatatcatctcatatccgatgtgagactctta |
30849516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 31961218 - 31961145
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||||||||||||| |||| | |||| |||||| ||||||||||| |
|
|
| T |
31961218 |
ttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacatatctgatgtgggactcttaaca |
31961145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 2736435 - 2736519
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||| |||||||||||| ||||||||||| |||| ||| || ||||||||||| |||||||||| |
|
|
| T |
2736435 |
acaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaactcttaaca |
2736519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 2737203 - 2737287
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||| |||||||||||| ||||||||||| |||| ||| || ||||||||||| |||||||||| |
|
|
| T |
2737203 |
acaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaactcttaaca |
2737287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 3680043 - 3679979
Alignment:
| Q |
30 |
gaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| || | ||||||| ||||||||||||||| |
|
|
| T |
3680043 |
gaggattgcccccagttataaacacattgtcagactatcacttatccgacgtgagactcttaaca |
3679979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 5572417 - 5572501
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||| ||||| ||| ||||||| |||||||| | | ||||| ||||||||||||| |||||| |
|
|
| T |
5572417 |
acaaaaccgacttgtgaggtgaggatggccccaacttataaacaaattgtcaggcaaactcctaaccgatgtgagacttttaaca |
5572501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 2736217 - 2736284
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||| ||||| |||||||| |||||| |||| |
|
|
| T |
2736217 |
ggtgaggattgtccccacttataaacacattgtcaggtcatctcctacccgatgtgggactctcaaca |
2736284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 6237740 - 6237819
Alignment:
| Q |
15 |
accggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||| |||||||||| || | | ||||| ||||| ||||||||||| |
|
|
| T |
6237740 |
accggcttgtgaggtgaggattgccctcacttataaatacattgtcaggccttcacttatccaatgtgggactcttaaca |
6237819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 13353450 - 13353403
Alignment:
| Q |
47 |
ataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
13353450 |
ataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
13353403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 19712765 - 19712722
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaaca |
53 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
19712765 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaaca |
19712722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 47 - 94
Target Start/End: Complemental strand, 33796575 - 33796528
Alignment:
| Q |
47 |
ataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
33796575 |
ataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
33796528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 90
Target Start/End: Original strand, 10314039 - 10314124
Alignment:
| Q |
4 |
atccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||| ||||| | ||||| | |||||||||| || ||| ||||||||||||||| |
|
|
| T |
10314039 |
atccttacaaaaccggtttgtgaggtgacgattgcctccacttaaaaacatttcgtcagaccatctcttat-cgatgtgagactctt |
10314124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 5572651 - 5572732
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| ||||||| ||||||| ||| ||||| ||||||| || |||||||| |
|
|
| T |
5572651 |
aaaccggcttgtgaggtgaggatggcccccacttataaacaaattgtcatgccaactcctaaacgatgtgggattcttaaca |
5572732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 1788714 - 1788762
Alignment:
| Q |
16 |
ccggcttgtggggtgaggattgcccccactcataaacacattgtcagac |
64 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
1788714 |
ccggcttgtgtggtgaagattgcccccacttataaacactttgtcagac |
1788762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 21215036 - 21214952
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||| || ||||| |||||||| ||| ||||||||||||| ||||||| ||||| ||| ||| ||||||||||| |
|
|
| T |
21215036 |
acaaaaccgacttttgaggtgatgattgcccaaacttataaacacattgtgagaccatcacctattcgacgtgtgactcttaaca |
21214952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 5269282 - 5269320
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5269282 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
5269320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 13740732 - 13740674
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatg |
68 |
Q |
| |
|
||||||||| ||| || || |||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
13740732 |
acaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcagaccatg |
13740674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 13740967 - 13740885
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||| |||||| ||||||| |||||||| ||| | ||||||||||| |||||||| |
|
|
| T |
13740967 |
acaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactcttaa |
13740885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 13746232 - 13746174
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatg |
68 |
Q |
| |
|
||||||||| ||| || || |||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
13746232 |
acaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcagaccatg |
13746174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 13746467 - 13746385
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||| |||||| ||||||||||| |||||| ||||||| |||||||| ||| | ||||||||||| |||||||| |
|
|
| T |
13746467 |
acaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactcttaa |
13746385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 15101120 - 15101158
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15101120 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
15101158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 16722840 - 16722918
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactc |
88 |
Q |
| |
|
|||||| ||||||||| |||||| ||||| |||||| ||||||| ||| |||| |||| | ||||||||||| ||||| |
|
|
| T |
16722840 |
acaaaatcggcttgtgaggtgagaattgctcccacttataaacagattatcaggccatcacatatccgatgtgggactc |
16722918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 16876839 - 16876877
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16876839 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
16876877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 16877019 - 16877057
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16877019 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
16877057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 17147914 - 17147952
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17147914 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
17147952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 28149888 - 28149850
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28149888 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
28149850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 94
Target Start/End: Complemental strand, 3713086 - 3712997
Alignment:
| Q |
5 |
tccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||| ||| || |||||| |||||| |||| |||||||||||||||| ||| || |||||||||| || |||||||| |
|
|
| T |
3713086 |
tccttataaaaccgacttttgaggtgagatttgcccgcacttttaaacacattgtcagatcattaccaatccgatgtgcgattcttaaca |
3712997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 43
Target Start/End: Complemental strand, 8026655 - 8026622
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccca |
43 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
8026655 |
acaaaaccggcttgtgaggtgaggattgccccca |
8026622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 19648351 - 19648306
Alignment:
| Q |
49 |
aaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||| |||||| |
|
|
| T |
19648351 |
aaacacattgtcagaccatctcatatccgatgtgggacttttaaca |
19648306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 93
Target Start/End: Original strand, 1788993 - 1789064
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||| ||||| |||| |||| ||| ||| ||||||||||| ||||| | |||||||||||| |||||||||| |
|
|
| T |
1788993 |
ttgtgaggtgaagattacccctacttatagacacattgtcaaaccattttctatccgatgtg-gactcttaac |
1789064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 62
Target Start/End: Complemental strand, 3713397 - 3713341
Alignment:
| Q |
6 |
ccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||| |||||| || |||||||||||| | ||| |||||||||||||||| |
|
|
| T |
3713397 |
ccttacaaaatcggcttttgatgtgaggattgcctcaacttataaacacattgtcag |
3713341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 11085852 - 11085780
Alignment:
| Q |
22 |
tgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| |||||| ||||| |||||| ||||| | |||| ||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
11085852 |
tgtgaggtgagcattgctcccacttataaatatattggcaggtcatctcctatccgatgtgagacttttaaca |
11085780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 24554400 - 24554317
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||| |||| ||||||||||||||| ||| ||||| ||||||| | ||||| || |||| |||||| ||||||||||| |
|
|
| T |
24554400 |
acaaaatcggtttgtaaggtgaggattgcccc-actaataaatacattgttaaaccatctcatatctgatgtgtgactcttaaca |
24554317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 102)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 41666790 - 41666874
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
41666790 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
41666874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 41667026 - 41667110
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
41667026 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
41667110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 30770289 - 30770384
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||||||||||| ||||||||||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
30770289 |
ctcatccttacaaaaccagcttatgaggtgaggattgcccccacttataaacacattgtcaagccatgtcctatccaaagtgagactcttaacaga |
30770384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 24346536 - 24346618
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
24346536 |
aaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
24346618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 30758323 - 30758409
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||| || |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
30758323 |
ctcatccttacaaaaccggcttatgaggtgaggattgcccccccttataaacacattgtcaggccatgtcctatccgatgtgggact |
30758409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 18333498 - 18333582
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
18333498 |
acaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctcctatccgatgtgggattcttaaca |
18333582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 8081146 - 8081231
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
8081146 |
acaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
8081231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 30770073 - 30770166
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||| |||| |||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
30770073 |
ctcatccttacaaaaccggtttatgaggtgaggattgcccccacttttaaaaacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
30770166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 2063767 - 2063850
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| | ||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2063767 |
acaaaaccgacttgtgag-tgaggattgcccccacttataaacacattgtcagaccatgttctatccgatgtgggactcttaaca |
2063850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 88
Target Start/End: Complemental strand, 15480373 - 15480295
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactc |
88 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
15480373 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactc |
15480295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 24269906 - 24269987
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| |||||||||| |||| ||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
24269906 |
aaaaccggcttgtgaggtgaggattacccc-acttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
24269987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 24528591 - 24528529
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcct |
72 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24528591 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcct |
24528529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 9368646 - 9368561
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| ||||||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
9368646 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcacgccatctcctatccgatgtatgactcttaacag |
9368561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 94
Target Start/End: Original strand, 17150258 - 17150350
Alignment:
| Q |
2 |
tcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| || | ||| ||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
17150258 |
tcatccttacaaaactggttggtgaggtgaggattgcccccacttataaacacattttcagaccatctcctatccgatgttgaactcttaaca |
17150350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 19705954 - 19705870
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||| |||||||||||||||| | |||||||| |||||||| ||||||||||| |
|
|
| T |
19705954 |
acaaaaccggcttataaggtgaggattgcccccacttataaacacattgtcaggctatgtcctacccgatgtgggactcttaaca |
19705870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 24487678 - 24487762
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||| ||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
24487678 |
acaaaaccggcttgtgaggtgaggattacccccacttataaacatattttcagaccaactcctaaccgatgtgagactcttaaca |
24487762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 27133026 - 27133110
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||||| |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
27133026 |
acaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
27133110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 37782083 - 37782167
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
37782083 |
acaaaaccagcttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacctatccgatatgagactattaaca |
37782167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 90
Target Start/End: Complemental strand, 15438926 - 15438848
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||| ||||||||||| ||||||||| || |||||||||||| |||||| |
|
|
| T |
15438926 |
aaaatcggcttgtgaggtgaggattgcccccacttataaacacattatcagaccatctcatatccgatgtgaaactctt |
15438848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 6637650 - 6637570
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| |||||||||||||||| |||| ||||| |||||||| ||||||||||| |
|
|
| T |
6637650 |
aaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatttcctaaccgatgtg-gactcttaaca |
6637570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 21306938 - 21306861
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| ||||| |||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
21306938 |
acaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtccgatgtgggact |
21306861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 21314776 - 21314699
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| ||||| |||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
21314776 |
acaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtccgatgtgggact |
21314699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 95299 - 95383
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||| ||||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
95299 |
acaaaaccggcttgtgagatgaggattgtccccacttataaacacattgtcaggtcatcacctatccgatgtgtgactcttaaca |
95383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 24346770 - 24346854
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| ||| |||||||| ||||| |||||||||| ||||||| ||| ||||||| ||||||||||| |
|
|
| T |
24346770 |
acaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtcttattcgatgtgggactcttaaca |
24346854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 24647747 - 24647663
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| | |||||||||||||| | |||| ||||||||||||| ||||||||||| |
|
|
| T |
24647747 |
acaaaaccggcttgtgaggtgaggattgccaccagttataaacacattgtccggccatcacctatccgatgtgggactcttaaca |
24647663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25258334 - 25258418
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||| ||||| || ||||||||| ||| ||||| ||||||||||| |
|
|
| T |
25258334 |
acaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaaca |
25258418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25322124 - 25322208
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||| ||||| || ||||||||| ||| ||||| ||||||||||| |
|
|
| T |
25322124 |
acaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaaca |
25322208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 15480610 - 15480524
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattg--cccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |||||||| ||||||| ||||||| |||| |||||| ||||||||||| |
|
|
| T |
15480610 |
acaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcatatctgatgtgggactcttaaca |
15480524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 2061971 - 2062049
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactc |
88 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||||||| |||||||||||||||| |||||| ||||||| |||| ||||| |
|
|
| T |
2061971 |
acaagaccggcttgtgaggtgaagattgcccccacttataaacacattgtcaggccatgttctatccggtgtgggactc |
2062049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 13701101 - 13701183
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||| |||||||||||||| || ||| |||||||||||||| ||||||||| |
|
|
| T |
13701101 |
acaaaaccgactcttggggtgagaattgcccccacttataaacacattgtcggatcatttcctatccgatgtgggactcttaa |
13701183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 79
Target Start/End: Complemental strand, 24531650 - 24531581
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgat |
79 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
24531650 |
acaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcctctccgat |
24531581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 1564600 - 1564680
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||| |||| |||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
1564600 |
acaaaactgtcttgtgatgtgaggattgcccccacttataatcacattgtcagaccatctcttatccgatgtgggactctt |
1564680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 8098368 - 8098285
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
8098368 |
acaaaaccggcttgtgaggtgaggattgcccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
8098285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 13296943 - 13296859
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||| ||||||| |||||||||||| ||||| |||||| | ||||||||||| |
|
|
| T |
13296943 |
acaaaaccggtttgtgaggtgagggttgcccccacttataaacaaattgtcagaccaactcctaaccgatgcgggactcttaaca |
13296859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 17352468 - 17352551
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||||||||||||||| ||| || ||| ||||||| ||||||||||| |
|
|
| T |
17352468 |
acaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatctcttat-cgatgtgggactcttaaca |
17352551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 21209954 - 21210038
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| |||| ||||||| ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
21209954 |
acaaaaccggcttgtgaggtgagaattgtccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21210038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 17 - 92
Target Start/End: Complemental strand, 9368874 - 9368799
Alignment:
| Q |
17 |
cggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||| ||||| |||||||||||| ||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
9368874 |
cggcttgtgaagtgagaattgcccccacttataaacacattgtcatgccatctcctatccgatgtgggactcttaa |
9368799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 38976984 - 38976913
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||| ||| |||||||||||||||||| ||||||||| |||||| |
|
|
| T |
38976984 |
acaaaaccggtttgtgaggtgaggattgtcccaacttataaacacattgtcagacaatgtcctattcgatgt |
38976913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 6919225 - 6919311
Alignment:
| Q |
8 |
ttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |||||||||||||||| ||| || ||| |||||| ||||||||||| |
|
|
| T |
6919225 |
ttacaaaaccggcttttaaggtgaggattgcccccactaataaacacattgtcaggtcatctcttatttgatgtgggactcttaaca |
6919311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 6413459 - 6413536
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagact |
87 |
Q |
| |
|
|||||| |||||| || ||||||||||||||||||| |||||||||||||||| ||| || ||||| |||||||||| |
|
|
| T |
6413459 |
acaaaatcggcttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcatatccaatgtgagact |
6413536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 6637885 - 6637804
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||| |||||||||||| |||||| ||| |||||||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
6637885 |
aaaccggtttgtgaggtgaggattgcacccacttatagacacattgtcaggtcatctcctaaccgatgtgggactcttaaca |
6637804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 24270138 - 24270223
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtc-ctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| ||| |||||||| ||||| |||||||||| ||||||| ||| ||||||| ||||||||||| |
|
|
| T |
24270138 |
acaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtctttattcgatgtgggactcttaaca |
24270223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 37656664 - 37656582
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||| ||||||||||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
37656664 |
acaaaaccggcttgtgatgtgaggatttccc--acttataaacacattgtcagaccattacctatccgacgtgggactcttaaca |
37656582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 4481604 - 4481680
Alignment:
| Q |
18 |
ggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||||||| ||| | |||||||||||| ||||||||||| |
|
|
| T |
4481604 |
ggcttgtgacgtgaggattgcccccatttataaacacattgtcaggccaacttctatccgatgtgggactcttaaca |
4481680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 20510675 - 20510759
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| || || || ||||||||||||||||||| ||||||| |||||||| |||| ||||||||||||| | ||||||||| |
|
|
| T |
20510675 |
acaaaactggtttttgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatccgatgtggggctcttaaca |
20510759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 33337271 - 33337355
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||| ||||| ||||| ||||||||||||| ||||||| |||||||| |||| ||||||| ||||| ||||||||||| |
|
|
| T |
33337271 |
acaaaatcggtttgtgaggtgatgattgcccccacttataaacatattgtcaggccatcacctatccaatgtgggactcttaaca |
33337355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 42295630 - 42295546
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| ||||||| ||| |||| ||| ||||| | |||||| ||||||||||| |
|
|
| T |
42295630 |
acaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattatcaggccaactcctaactgatgtgggactcttaaca |
42295546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 94
Target Start/End: Complemental strand, 13358431 - 13358368
Alignment:
| Q |
31 |
aggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| | || ||||||| |||||||||||||||||| |
|
|
| T |
13358431 |
aggattacccccacttataaacacattgtcagccaatctcctatctgatgtgagactcttaaca |
13358368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 43117931 - 43117848
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatg-tgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||| | |||||||||||| || | |||||||||||||||| ||||||||| ||||| | || ||||||||||| |
|
|
| T |
43117931 |
aaaaccggcttgtgagatgaggattgccctcatttataaacacattgtcaggccatgtcctgtccgaagttgggactcttaaca |
43117848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 60138 - 60092
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
60138 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacat |
60092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 6413692 - 6413773
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| || ||||||||||| ||| ||| ||||||||||||||| | ||| || ||||||||||| ||||||||||| |
|
|
| T |
6413692 |
aaaaccggcttatgaggtgaggattgtccctacttataaacacattgtca-atcatctcatatccgatgtgggactcttaaca |
6413773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 8287852 - 8287771
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||||||||||||| |||| |||||| ||||||| ||||||| |||| ||||||| ||||| |||||||| ||||||||| |
|
|
| T |
8287852 |
acaaaaccggcttgtgaggtggggattg-ccccacttataaacaaattgccagaccaactcctagccgatgtgtgactcttaa |
8287771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 76
Target Start/End: Original strand, 37656970 - 37657036
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatcc |
76 |
Q |
| |
|
||||||||| |||||| ||| |||||| |||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
37656970 |
acaaaaccgacttgtgaggtaaggattacccccacttataaacacattgtcagaccatcacctatcc |
37657036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 12034742 - 12034657
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||| | |||||||| ||| ||| |||| || |||||||| || ||||||||||| |
|
|
| T |
12034742 |
tacaaaactggcttgtgaggtgaggatttcccccatttataaacacgttggcaggccatctcttatccgatatgggactcttaaca |
12034657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 15590213 - 15590140
Alignment:
| Q |
22 |
tgtggggtgaggattgccc-ccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||| |||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
15590213 |
tgtgaggtgaggattgccctccacttataaatccattgtcagaccatctcatattcgatgtgagactcttaaca |
15590140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 170584 - 170664
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| |||||||||| | ||||||| | | ||||||||| ||||||| |
|
|
| T |
170584 |
acaaaaccggcttgtgaggtgaggactgcccccacttataaacacatgcttagaccatcttttgtccgatgtgtgactctt |
170664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 7607645 - 7607561
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||| | ||||| ||||||| |||||| | |||| |||| ||||||||||||||||||| |
|
|
| T |
7607645 |
acaaaaccggcttgtgaggtgaagattgtctccacttataaacagattgtcgggccataacctagtcgatgtgagactcttaaca |
7607561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 8098602 - 8098518
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| | | || ||||||| |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
8098602 |
acaaaaccggcttgtgaggtgaggattgtctgcgcttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
8098518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 19522138 - 19522090
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattg |
58 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||| |
|
|
| T |
19522138 |
acaaaaccggcttgtgaggtgaggattgcccccactaataaacaaattg |
19522090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 6919470 - 6919544
Alignment:
| Q |
19 |
gcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||| |||| ||||||| ||||||||||||||| | ||| || ||||| ||||||||||||||||| |
|
|
| T |
6919470 |
gcttgtgaggtgagaattgtccccacttataaacacattgtca-atcatctcatatcctatgtgagactcttaaca |
6919544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 3859351 - 3859425
Alignment:
| Q |
20 |
cttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||||| || |||| ||||||||||| |||| ||||| ||||||||| || ||||||||||| |
|
|
| T |
3859351 |
cttgtgaggtgaggattgtcctcacttataaacacattatcaggtcatgttctatccgatatgggactcttaaca |
3859425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 18333732 - 18333814
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
|||||||||||||||| ||||| |||| ||||| ||| |||||||||||| || |||| ||||||| |||||| |||||||| |
|
|
| T |
18333732 |
acaaaaccggcttgtgaggtgacgattaccccccacttataaacacattgcaaggccatctcctatctgatgtgggactctta |
18333814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 26137142 - 26137224
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| | ||||||| |||||| | ||| |||||| ||||||| ||||||||| |
|
|
| T |
26137142 |
acaaaaccggtttgtgagatgaggattgcccccatttataaacatgttgtcatatcatttcctattcgatgtgggactcttaa |
26137224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 79
Target Start/End: Complemental strand, 37781776 - 37781709
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgat |
79 |
Q |
| |
|
||||||||| |||||| ||||||||||| || ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
37781776 |
acaaaaccgacttgtgaggtgaggattgtcc--acttataaacacattgtcagaccatcacctatccgat |
37781709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 90
Target Start/End: Original strand, 2985272 - 2985341
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||| |||||||||| |||||| | ||||||||||||||||| ||| || ||||||| ||| ||||||| |
|
|
| T |
2985272 |
ttgtgaggtgaggattacccccaattataaacacattgtcagatcatctcatatccgaggtgtgactctt |
2985341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 29909754 - 29909839
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcat-aaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| || ||| | ||||||| |||| ||||| | |||||| ||||||||||| |
|
|
| T |
29909754 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaaaaaaattgtcaaaccaactcctaactgatgtgggactcttaaca |
29909839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 7369775 - 7369731
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
7369775 |
acaaaaccggcttgtgaggtgaggactgcccccacttataaacac |
7369731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 66
Target Start/End: Complemental strand, 13296724 - 13296668
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagacca |
66 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| ||||| | ||||||| |||| |
|
|
| T |
13296724 |
acaaaactggcttgtgaggtgaggattgcccccacttataaataaattgtcaaacca |
13296668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 29909520 - 29909604
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||| ||||||||||||| ||||| ||||| | |||||||| ||| ||||| ||||||| ||||||||||| |
|
|
| T |
29909520 |
acaaaaccgatttgtgaggtgaggattgcctccacttataaataaattgtcaggccaactcctaaccgatgtcggactcttaaca |
29909604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 32908752 - 32908804
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcaga |
63 |
Q |
| |
|
||||||||| ||||| ||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
32908752 |
caaaaccggtttgtgaggtgatgattgcctccacttataaacacattgtcaga |
32908804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 37405140 - 37405056
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || |||| |||||||||||||| | |||||| || ||||||||| || | | |||||| ||||||||||| |
|
|
| T |
37405140 |
acaaaaccggcttttgaggtggggattgcccccacttacaaacactttttcagaccatctctcaactgatgtgggactcttaaca |
37405056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 17899484 - 17899539
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||| |||||| ||||| || ||||||||||||||||||| |||||||||| |
|
|
| T |
17899484 |
ctcatcctcacaaaatcggctcatgaggtgaggattgcccccacttataaacacat |
17899539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 94
Target Start/End: Complemental strand, 24528797 - 24528742
Alignment:
| Q |
39 |
ccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||| || |||||| ||||||||||| |
|
|
| T |
24528797 |
ccccacttatatacacattgtcaggccatgtcctctcagatgtgggactcttaaca |
24528742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 25258127 - 25258162
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccact |
45 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25258127 |
acaaaaccggcttgtgaggtgaggattgcccccact |
25258162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 25321917 - 25321952
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccact |
45 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25321917 |
acaaaaccggcttgtgaggtgaggattgcccccact |
25321952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 94
Target Start/End: Complemental strand, 29239935 - 29239881
Alignment:
| Q |
39 |
ccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||||||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
29239935 |
ccccacttataaacacattgtcaga-catcacctatcagatgtgagactcttaaca |
29239881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 48113 - 48151
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48113 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
48151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 48320 - 48358
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48320 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
48358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2908571 - 2908609
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2908571 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
2908609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2908778 - 2908816
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2908778 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
2908816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 7092200 - 7092155
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7092200 |
acaaaactggcttgtgaggtgaggattgcccccactc-taaacacat |
7092155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 13413679 - 13413641
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13413679 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
13413641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 35526997 - 35527035
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35526997 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
35527035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 35527283 - 35527321
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35527283 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
35527321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 37656741 - 37656779
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37656741 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
37656779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 13700622 - 13700707
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgat-gtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||| || |||||| |||| || ||| ||||||||||||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
13700622 |
acaaaaccggcttttgaggtgagaattgtccaaacttataaacacattgtcaagtcatctcctatccgatggtgggactcttaaca |
13700707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 56
Target Start/End: Original strand, 16707059 - 16707104
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
||||||| ||||||| ||| ||||||||||||||| |||||||||| |
|
|
| T |
16707059 |
caaaaccagcttgtgaggttaggattgcccccacttataaacacat |
16707104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 17017127 - 17017208
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| |||||| ||||| ||||| ||||||| |||||||||||||| |||| | ||||| ||| || ||||||||||| |
|
|
| T |
17017127 |
aaaccgacttgtgaggtgatgattgaccccacttataaacacattgtcgagccatcttctatctgatatgggactcttaaca |
17017208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 26137378 - 26137463
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaaca-cattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||| | ||||||||| | ||||| ||||| | |||||||||||||| || ||||| || |||||||||||||| |
|
|
| T |
26137378 |
acaaaaccaacttgtgagatgaggattgtcgccacttataaaaaacattgtcagaccatctcatatccaatatgagactcttaaca |
26137463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 39
Target Start/End: Complemental strand, 28156124 - 28156087
Alignment:
| Q |
2 |
tcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28156124 |
tcatccttacaaaaccggcttgtaaggtgaggattgcc |
28156087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 34457191 - 34457154
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgc |
38 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34457191 |
ctcatccttacaaaaccggcttgtaaggtgaggattgc |
34457154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 97
Target Start/End: Original strand, 36040519 - 36040596
Alignment:
| Q |
20 |
cttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacagat |
97 |
Q |
| |
|
|||||| ||||| |||||| ||||| ||||||||||| ||||| ||| | ||||| ||||||| |||||||| |||| |
|
|
| T |
36040519 |
cttgtgaggtgatgattgcaaccacttataaacacattatcagatcatcttctatctgatgtgaaactcttaatagat |
36040596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 92
Target Start/End: Complemental strand, 16293383 - 16293320
Alignment:
| Q |
28 |
gtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||| ||| ||||| |||||||||||||||| |
|
|
| T |
16293383 |
gtgaggattgcccc-acttataaacacattgttagatcatcccctatttgatgtgagactcttaa |
16293320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 16704013 - 16704065
Alignment:
| Q |
42 |
cactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| ||||||||||||| | ||||| ||||||| ||||||||||||||||| |
|
|
| T |
16704013 |
cacttataaacacattgttaaaccatctcctatctaatgtgagactcttaaca |
16704065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 17352709 - 17352785
Alignment:
| Q |
18 |
ggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||| |||| |||||||| ||||||||||||| || ||| || || ||||||| ||||||||||| |
|
|
| T |
17352709 |
ggcttgtgaggtgaagattacccccacttataaacacattgttaggtcatctctcattcgatgtgggactcttaaca |
17352785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 18885500 - 18885429
Alignment:
| Q |
22 |
tgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| ||||||| ||| | ||||| ||||||||||||||||||||| | ||| ||||||| ||||||||||| |
|
|
| T |
18885500 |
tgtgaggtgagggttgtctccacttataaacacattgtcagaccatcttttat-cgatgtgggactcttaaca |
18885429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 19522371 - 19522288
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| ||| ||||| | |||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
19522371 |
acaaaatcggcttgtgaggtgattattgcccc-acttataaataaattgtcagtccaactcctaaccgatgtgggactcttaaca |
19522288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 28358044 - 28358080
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattg |
37 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28358044 |
ctcatccttacaaaaccggcttgtaaggtgaggattg |
28358080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 28510142 - 28510090
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
||||||||||||| || | ||||||||||| |||| |||||||||||||||| |
|
|
| T |
28510142 |
acaaaaccggcttatgagatgaggattgccttcacttataaacacattgtcag |
28510090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 54
Target Start/End: Complemental strand, 31974491 - 31974443
Alignment:
| Q |
6 |
ccttacaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
||||||||||| |||| ||| |||||||| |||||||||| |||||||| |
|
|
| T |
31974491 |
ccttacaaaactggctcgtgaggtgaggactgcccccacttataaacac |
31974443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 38376826 - 38376790
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattg |
37 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38376826 |
ctcatccttacaaaaccggcttgtaaggtgaggattg |
38376790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 38731871 - 38731939
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccga |
78 |
Q |
| |
|
|||||| || |||||| ||||||||||| | |||| ||||||||||||||||| ||| || ||||||| |
|
|
| T |
38731871 |
acaaaatcgacttgtgaggtgaggattgttctcacttataaacacattgtcagatcatctcatatccga |
38731939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 8e-27; HSPs: 92)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 29469656 - 29469571
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
29469656 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag |
29469571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 26239949 - 26240033
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26239949 |
acaataccgacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtcggactcttaaca |
26240033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 29469891 - 29469807
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
29469891 |
acaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
29469807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 21861345 - 21861260
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||| |||||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
21861345 |
acaaaaccggcttgtaaggtgaggattgccctcacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag |
21861260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 43688195 - 43688276
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| | ||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
43688195 |
aaaccggcttgagaggtaaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
43688276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 47710494 - 47710409
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| ||||||||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
47710494 |
acaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaacag |
47710409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 47722150 - 47722065
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacag |
95 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| ||||||||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
47722150 |
acaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaacag |
47722065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 36277259 - 36277343
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| || |||||| ||||||||||||||||||| |||||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
36277259 |
acaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcttgtccgatgtgagactcttaaca |
36277343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 2404209 - 2404291
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| |||||||||||||||| |||| ||||| |||||||| ||||||||||| |
|
|
| T |
2404209 |
aaaaccgacttgtggggttaggattgcccccacttataaacacattgtcagtccatctcctaaccgatgtgggactcttaaca |
2404291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 4454836 - 4454770
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4454836 |
ctcatccttacaaaaccggtttgtgaggtgaggattgcccccacttataaacacattgtcagaccat |
4454770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 1596642 - 1596561
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || ||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
1596642 |
aaaccggcttgtaaggtgaggattgcccccacttattaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
1596561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 1596880 - 1596795
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| ||||||| || ||||||||| ||||||||| ||||||||||| |
|
|
| T |
1596880 |
tacaaaaccggcttgtaaggtgaggattgcccccacttataaaaacattgttaggccatgtcctgtccgatgtgggactcttaaca |
1596795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 6 - 83
Target Start/End: Original strand, 3520069 - 3520146
Alignment:
| Q |
6 |
ccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtga |
83 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3520069 |
ccttataaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatccgatgtga |
3520146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 48243094 - 48243176
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| || |||| |||||| ||||||||||| |
|
|
| T |
48243094 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagacca--tcatatctgatgtgggactcttaaca |
48243176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 9689123 - 9689207
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||| |||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
9689123 |
acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca |
9689207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 21054986 - 21055070
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| |||| |||||||||| || ||||||||||| |
|
|
| T |
21054986 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatccgatatgggactcttaaca |
21055070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 21861580 - 21861496
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
21861580 |
acaaaatcggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca |
21861496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 26562106 - 26562190
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||| |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
26562106 |
acaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
26562190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 2404443 - 2404525
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||| |||||||||||||||| || | |||||||||| ||| ||||||||||| |
|
|
| T |
2404443 |
aaaaccgacttgtggggtgaggattgcccctacttataaacacattgtcagtccgtctcctatccgacgtgggactcttaaca |
2404525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 3038117 - 3038201
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||| |||| || || ||| ||||||| ||||||||||| |
|
|
| T |
3038117 |
acaaaaccggcttgtgacgtgaggattgcccccacttataaacacattgttagacaatctcttattcgatgtgggactcttaaca |
3038201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 3393033 - 3392949
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| |||||| ||| ||||||| |||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3393033 |
acaaaatcggcttgtgaggtgagaattttccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca |
3392949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 23839110 - 23839190
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||| ||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
23839110 |
acaaaaccggcttgtgaggtgaggatttcccccacttataaacagattgttagaccatctcttatccgttgtgagactctt |
23839190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 34027444 - 34027360
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||| || |||||||| |
|
|
| T |
34027444 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggattcttaaca |
34027360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 42985156 - 42985240
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| || |||||| ||||||||||||| ||||| ||||||||||||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
42985156 |
acaaaatcgacttgtgaggtgaggattgcctccacttataaacacattgtcaaaccatcacatatccgatgtgagactcttaaca |
42985240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 48661588 - 48661672
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| |||||||||| ||| ||||||| |||||| ||||||||||| |
|
|
| T |
48661588 |
acaaaaccggcttgtgaggtgaggattgcccccacctataaatacattgtcaggtcatctcctatctgatgtgggactcttaaca |
48661672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 33996120 - 33996195
Alignment:
| Q |
18 |
ggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
33996120 |
ggcttgtgaggtgaggattgtccccacgtataaacacattgtcagacaatgtcttatccgatgtgggactcttaac |
33996195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 33996344 - 33996426
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||| ||||| ||||| | || ||||||||||||||||||| ||||||||| |
|
|
| T |
33996344 |
acaaaaccgacttgtgaggtgaagattgcccccacttataaatacattattaggccatgtcctatccgatgtgggactcttaa |
33996426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 1793797 - 1793719
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||| ||||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
1793797 |
acaaaacctgcttgtgaggtgaggattgcccccactaataa--acattgtcagaccatctcttatccaatgtgagactctt |
1793719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 2544248 - 2544332
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
2544248 |
acaaaactggcttgtaaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
2544332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 2544480 - 2544564
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||| ||| ||||||||||| |
|
|
| T |
2544480 |
acaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgacgtgggactcttaaca |
2544564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 6634906 - 6634822
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||| ||||||| |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
6634906 |
acaaaactagcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
6634822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 25620187 - 25620135
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25620187 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcag |
25620135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 31892202 - 31892118
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||| ||||||||| | || |||||||||||||| |||| |||||| |
|
|
| T |
31892202 |
acaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcatgctatatcctatccgatgtgggacttttaaca |
31892118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 31892438 - 31892354
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||| ||||| ||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
31892438 |
acaaaaccggcttgtgaggtgaagattgtccccacttataaatacattgtcatgtcatgttccatccgatgtgagactcttaaca |
31892354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 36993107 - 36993191
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| ||||||| |||||| ||||| || ||| |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
36993107 |
acaaaaccagcttgtgaggtgagcattgctcctacttataaacacattgtcagaccatgtcatatccgatgttgaactcttaaca |
36993191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 9 - 93
Target Start/End: Original strand, 44874378 - 44874462
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||| ||| ||||| |||||||||| |||||||| |||||||||||||||| || |||||||||||||| |||||||||| |
|
|
| T |
44874378 |
tacaaaatcggtttgtgaggtgaggatttcccccacttataaacacattgtcaggttatctcctatccgatgtgggactcttaac |
44874462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 94
Target Start/End: Complemental strand, 4267888 - 4267821
Alignment:
| Q |
27 |
ggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
4267888 |
ggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
4267821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 96
Target Start/End: Complemental strand, 10903136 - 10903049
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg-agactcttaacaga |
96 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||| ||||||| ||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
10903136 |
acaaaaccggcttgtgaggtgaggattacccctacttataaacatattgtcaagccatgtcctattcgatgtgtggactcttaacaga |
10903049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 94
Target Start/End: Original strand, 3519776 - 3519842
Alignment:
| Q |
28 |
gtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
3519776 |
gtgaggattacccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
3519842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 31257064 - 31257146
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||| || ||||| ||||| ||||||||||||| ||||||| |||||||||||| | ||| |||||||||||||||||| |
|
|
| T |
31257064 |
acaaaactggtttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaacttctaaccgatgtgagactcttaa |
31257146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 36277026 - 36277108
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||| |||||| |||| ||||||| |||||||||||||||||| ||| | | || |||||||||||||||||| |
|
|
| T |
36277026 |
aaaacctgcttgtgaggtgagaattgtccccacttataaacacattgtcagactatgccatgtctgatgtgagactcttaaca |
36277108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 6001467 - 6001552
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| ||| || || ||||||||||||||||||| ||||||| |||||||| ||| | |||||||||||| ||||||||||| |
|
|
| T |
6001467 |
tacaaaatcggtttctgaggtgaggattgcccccacttataaacatattgtcaggtcatcttctatccgatgtgggactcttaaca |
6001552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 25620423 - 25620338
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| ||| |||| ||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
25620423 |
tacaaaacctgcttgtgaggtggggattgcccctacttataagcacattgtcaggtcatgtcctatctgatgtaggactcttaaca |
25620338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 35308178 - 35308263
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||| ||||||||||||||| ||| ||||||| ||||||||| |||||||| |
|
|
| T |
35308178 |
tacaaaaccgaattgtgaggtgatgattgcccccacttataaacacattgtcatgacatctcctatctgatgtgagattcttaaca |
35308263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 46452684 - 46452599
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||| ||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
46452684 |
acaaaaccaacttgtgaggtgaggattgccccccacttataaacacattgtgtggtcatgtcctatccgatgtgggactcttaaca |
46452599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 17202230 - 17202146
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||| ||||||| |||||||| ||| || || |||||||| ||||||||||| |
|
|
| T |
17202230 |
acaaaaccggcttgtgagatgagaattgcccccacttataaacaaattgtcaggccaactcttaaccgatgtgggactcttaaca |
17202146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 31257300 - 31257384
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||| | |||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
31257300 |
acaaaaccggcttgtgaattaaggattgcccccacttataaataaattgtcagaccaactcctaaccgatgtgagacgcttaaca |
31257384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 32278918 - 32278990
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
||||||||||||| || ||||| ||||| ||||||| ||||||||||||||||||||| | ||||||||||| |
|
|
| T |
32278918 |
acaaaaccggcttatgaggtgacgattgtccccacttataaacacattgtcagaccatcacatatccgatgtg |
32278990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 34027678 - 34027594
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| |||||||| ||| | ||| | |||||| ||||||||||| |
|
|
| T |
34027678 |
acaaaaccggcttgtgaagtgaggattgcccccacttataaacaaattgtcaggccaacttctaactgatgtgggactcttaaca |
34027594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 48243470 - 48243554
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| |||||||||||||||| |||| | ||| | ||||| ||||||||||| |
|
|
| T |
48243470 |
acaaaaccggcttgtaagatgaggattgcccccacttataaacacattgtcaggccatcacatattcaatgtgggactcttaaca |
48243554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 4886377 - 4886310
Alignment:
| Q |
13 |
aaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatg |
80 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | ||||||| |||||||| ||||||| | ||||||| |
|
|
| T |
4886377 |
aaaccggcttgtgaggtgaggattgcccccattaataaacatattgtcaggccatgtcatgtccgatg |
4886310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 5522925 - 5522846
Alignment:
| Q |
15 |
accggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| ||||| |||||| |||||| | |||||||||||||||||| || ||| ||||||| ||||||||||| |
|
|
| T |
5522925 |
accggcttgtgaggtgaagattgctcccacttaaaaacacattgtcagaccaactcttatacgatgtgggactcttaaca |
5522846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 10882038 - 10882089
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
10882038 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtca |
10882089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 4268103 - 4268021
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||| ||||||| |||||||| ||| ||||| | |||||| ||||||||||| |
|
|
| T |
4268103 |
aaaaccggcttttgaggtgatgattgcccccacttataaacaaattgtcaggccaactcctaactgatgtgggactcttaaca |
4268021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 88
Target Start/End: Original strand, 32879648 - 32879726
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattg-cccccactcataaacacattgtcagaccatgtcctatccgatgtgagactc |
88 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| |||||||||||||||| |||| || || |||| ||| ||||| |
|
|
| T |
32879648 |
caaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccatctcttaaccgaagtgggactc |
32879726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 31485692 - 31485749
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccat |
67 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |||| |
|
|
| T |
31485692 |
acaaaaccggcttgtcaggtgaggattgcccccacttataaaaacattgtcaggccat |
31485749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 11211712 - 11211791
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||| ||||||| || |||| || ||||||| ||| ||||||| |
|
|
| T |
11211712 |
acaaaaccggcttgtgaggtgaggattg-ccccacttataaagacattgttaggccatctcttatccgacgtgggactctt |
11211791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 18826521 - 18826605
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| | ||||||| | |||| ||| |||||||| |||||||||||||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
18826521 |
acaaaatcagcttgtgagttgagaattacccccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca |
18826605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 31485457 - 31485541
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||| |||||||||||||||| |||| | |||| ||||| ||||||||||| |
|
|
| T |
31485457 |
acaaaaccagtttgtgatgtgaggattgcccccacttataaacacattgtcaggccatcacatatcttatgtgggactcttaaca |
31485541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 12 - 96
Target Start/End: Original strand, 36206098 - 36206182
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||| ||||||| ||||| || ||| ||||| |||||||| |||||||||||| |
|
|
| T |
36206098 |
aaaaccggcttgtgaggtgaagattgcctccacttataaacaaattgttaggccaactcctaaccgatgtggaactcttaacaga |
36206182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 40746066 - 40746150
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||| ||||| ||||| ||||| ||| || |||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
40746066 |
acaaaatcggtttgtgaggtgaagattgtcccttcttataaacacattgtctagccatgtcctatccgatgtgggactcttaaca |
40746150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 40746549 - 40746465
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||| |||||||| |||| ||||| |||||||| ||||||| |||||||| ||| ||||| || ||||| ||||||||||| |
|
|
| T |
40746549 |
acaaaactggcttgtgaggtgtggatttcccccacttataaacaaattgtcaggccaactcctaaccaatgtgggactcttaaca |
40746465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 40792821 - 40792881
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||| | || ||||| ||||||||||||||| |
|
|
| T |
40792821 |
ctcatccttacaaaatcggcttgtgaggtgaggactaccgccacttataaacacattgtca |
40792881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 94
Target Start/End: Original strand, 9688905 - 9688987
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| || |||| |||||||||||| ||||||||||| ||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
9688905 |
aaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatccgatgtggaactcttaaca |
9688987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 33834469 - 33834394
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
33834469 |
acaaaaccggcttgtgaggtgaagattgcccccac--------acattgtcagaccatcacctatccgatgtgggactcttaac |
33834394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 22574879 - 22574803
Alignment:
| Q |
17 |
cggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||| ||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
22574879 |
cggcttgtgaggtgaggattgccctcacttataaa-acattgtcatgtcatcacatatccgatgtgagactcttaaca |
22574803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 54
Target Start/End: Original strand, 30727150 - 30727195
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacac |
54 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
30727150 |
tacaaaaccagcttgtgaggtgaggattgcccccacttataaacac |
30727195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 89
Target Start/End: Original strand, 20305707 - 20305775
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactct |
89 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| | || ||| |||||||| ||||| |||||| |
|
|
| T |
20305707 |
ttgtgaggtgaggattgcccccacttataaacacattattggaacatctcctatccaatgtgggactct |
20305775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 22574656 - 22574572
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||| ||||| | |||| ||||||| ||| ||| |||| | ||||||||||| ||||||||||| |
|
|
| T |
22574656 |
acaaaaccggcttgtgaggtgagaattgctctcacttataaacagattatcaagccatcacatatccgatgtgggactcttaaca |
22574572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 81
Target Start/End: Original strand, 23796228 - 23796288
Alignment:
| Q |
21 |
ttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||||||| ||||||| | |||||||||| |
|
|
| T |
23796228 |
ttgtgaggtgatgattgcccccacttataaacacattgttagaccatcttttatccgatgt |
23796288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 28080715 - 28080632
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| |||||| |||| ||||||| ||| |||||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
28080715 |
acaaaaccgacttgtgaagtgaaaattgccct-acttataaacacattgtcaggtcatctcttatccgatgtgagactcttaaca |
28080632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 41191065 - 41190981
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||| | |||| ||||||| ||||||||| || | |||| |||||| ||||||||||| |
|
|
| T |
41191065 |
acaaaaccggcttgtgatgtgaggattgctctcacttataaacatattgtcagattatcacatatctgatgtgggactcttaaca |
41190981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 32474551 - 32474516
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccact |
45 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32474551 |
acaaaaccggcttgtgaggtgaggattgcccccact |
32474516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 43075343 - 43075394
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43075343 |
acaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca |
43075394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 43085570 - 43085621
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43085570 |
acaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca |
43085621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 43089241 - 43089292
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtca |
61 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43089241 |
acaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca |
43089292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 6783133 - 6783095
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6783133 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
6783095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 21821857 - 21821775
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
|||||| ||| ||||| | ||| ||||||||||||| || |||| |||||||| |||| || |||| ||||||||| |||||| |
|
|
| T |
21821857 |
acaaaatcggtttgtgagatgaagattgcccccacttattaacatattgtcaggccatctcatatctgatgtgagagtcttaa |
21821775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 23396704 - 23396666
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23396704 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
23396666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 31374860 - 31374822
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31374860 |
ctcatccttacaaaaccggcttgtaaggtgaggattgcc |
31374822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 63
Target Start/End: Original strand, 32279098 - 32279152
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcaga |
63 |
Q |
| |
|
|||||||| ||||||| ||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
32279098 |
tacaaaactggcttgttaggtgaggattgtccacacttataaacacattgtcaga |
32279152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 40121627 - 40121665
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
40121627 |
ctcatccttacaaaaccggcttgtagggtgaggagtgcc |
40121665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 40703420 - 40703458
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcc |
39 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
40703420 |
ctcatccttacaaaaccggcttgtgaggtgaggagtgcc |
40703458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 47849622 - 47849576
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
47849622 |
acaaaaccgggttgtgaggtgaggattgccccaacttataaacacat |
47849576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 4507217 - 4507132
Alignment:
| Q |
9 |
tacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||||| |||| ||||| ||||||| ||||||| ||| ||| |||| | |||| |||||||||||||||||| |
|
|
| T |
4507217 |
tacaaaaccagcttgtgaagtgaagattgtccccacttataaacatattagcaggccatcttgtatctgatgtgagactcttaaca |
4507132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 32292570 - 32292489
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatg-tcctatccgatgtgagactctt |
90 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||||| |||||||| | |||| |||| || ||||||||||||||||||| |
|
|
| T |
32292570 |
acaaatccggcttgtgaggtgaggaccgcccccacttataaacacttgttcaggccatactcttatccgatgtgagactctt |
32292489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40703661 - 40703694
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgagga |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
40703661 |
ctcatccttacaaaaccggcttgtgaggtgagga |
40703694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 2401411 - 2401331
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||| || |||||| |||| ||||| || |||| ||||||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
2401411 |
acaaaatcgacttgtgaagtgaagattgtccacacttataaacacattgtcagaccgcctcttatccgatgtgaaactctt |
2401331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 91
Target Start/End: Complemental strand, 9625463 - 9625383
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctta |
91 |
Q |
| |
|
||||||| |||||| |||||||||| ||||||| ||||| | ||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
9625463 |
caaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaactctta |
9625383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 14540794 - 14540858
Alignment:
| Q |
30 |
gaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| || ||| |||||||||||||||| ||| |||||||||||||| || |||||||| |
|
|
| T |
14540794 |
gaggattgtccttacttataaacacattgtcaggtcatctcctatccgatgtgtgattcttaaca |
14540858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 40746316 - 40746264
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcag |
62 |
Q |
| |
|
|||||| |||||| || |||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
40746316 |
acaaaatcggcttatgaggtgaggattgccctcacttataaacaaattgtcag |
40746264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 56
Target Start/End: Original strand, 40898957 - 40899001
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
40898957 |
aaaaccagcttgtgaggtgatgattgcccccacttataaacacat |
40899001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: scaffold0692
Description:
Target: scaffold0692; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 11 - 93
Target Start/End: Original strand, 5788 - 5870
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| |||||||||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
5788 |
caaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcagactatgtcttatccgatgtgggactcttaac |
5870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 66
Target Start/End: Original strand, 5578 - 5633
Alignment:
| Q |
11 |
caaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagacca |
66 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
5578 |
caaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtcaaacca |
5633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 20635 - 20542
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| | |||||||||||||||| |||| |||| ||||||||| ||||||||||| |
|
|
| T |
20635 |
ctcatccttacaaaaccagcttgtaaggtgaggattgcccccaattataaacacattgtcaggccatatcctgtccgatgtgggactcttaaca |
20542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0766 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0766
Description:
Target: scaffold0766; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 6325 - 6241
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| |||||||||||||||||| || || |||| |||||| ||||||||||| |
|
|
| T |
6325 |
acaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagactatctcttatctgatgtgggactcttaaca |
6241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 12 - 93
Target Start/End: Original strand, 69568 - 69649
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| ||||||| |||||||| |||||| ||||||| |||| |||||||||| |
|
|
| T |
69568 |
aaaaccggtttgtgaggtgaggattgcccccacttataaacagattgtcaggccatgttctatccgttgtgggactcttaac |
69649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 14354 - 14282
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtg |
82 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14354 |
acaaaaccggcttgtgaggtgatgattgtccccacttataaacacattgtcagaccatcacctatccgatgtg |
14282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 39 - 93
Target Start/End: Complemental strand, 14560 - 14506
Alignment:
| Q |
39 |
ccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
14560 |
ccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaac |
14506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 4462 - 4546
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||| ||||| | |||||| |||||||||| |
|
|
| T |
4462 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactgatgtggcactcttaaca |
4546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 288690 - 288770
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactctt |
90 |
Q |
| |
|
|||||||| ||||||| |||||||||||| |||| ||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
288690 |
acaaaaccagcttgtgaggtgaggattgcgcccagatataaatacattgtcagaccatctcctatccgatgtgggactctt |
288770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 96
Target Start/End: Complemental strand, 56510 - 56424
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaacaga |
96 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| || | ||||||| ||||||||| || ||||| |||||||| ||||||||||||| |
|
|
| T |
56510 |
acaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccgatgtgggactcttaacaga |
56424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 51287 - 51205
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
||||||| | |||||| ||||||||||||||||||| ||||||||||||||| | |||||||||||| || || |||||||||| |
|
|
| T |
51287 |
acaaaactgacttgtgaggtgaggattgcccccacttataaacacattgtca-aacatgtcctatccaatatgggactcttaac |
51205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0181 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0181
Description:
Target: scaffold0181; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 20990 - 20906
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| || |||| ||||| ||||||||||||||| |||| | ||||| |||||||||||| |
|
|
| T |
20990 |
acaaaaccggcttgtgaggtgaggattaccttcacttataaatacattgtcagaccatctccttactgatgtcagactcttaaca |
20906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 5706 - 5622
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||| | |||||||| |||||||| ||||||||||||||| |||| | ||||| |||||| ||||||||||| |
|
|
| T |
5706 |
acaaaaccggcttgtaagatgaggattacccccacttataaacacattgtcatgccatcttctatctgatgtgggactcttaaca |
5622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0729 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0729
Description:
Target: scaffold0729; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 2571 - 2476
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactc-ata-aacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| | || || ||| ||| ||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
2571 |
ctcaaccttacaaaaccggcttgtgaggtgaggattgtctcctctttatanaactcattgtcaggccatgtcatatccgatgtgggactcttaaca |
2476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0729; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 2735 - 2696
Alignment:
| Q |
55 |
attgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2735 |
attgtcagaccatgtcctatccgatgtgggactcttaaca |
2696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 3896 - 3813
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||| || ||||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
3896 |
acaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatccgatgtgggactcttaa |
3813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 4540 - 4457
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgccccc-actcataaacacattgtcagaccatgtcctatccgatgtgagactcttaa |
92 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||| || ||||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
4540 |
acaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatccgatgtgggactcttaa |
4457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 13393 - 13300
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||| | |||| | |||||||||||||| | || ||||| |||||| ||||||||||| |
|
|
| T |
13393 |
ctcatccttacaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca |
13300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 13147 - 13081
Alignment:
| Q |
15 |
accggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| | ||||| ||||| ||||||| |||||||||||| |
|
|
| T |
13147 |
accggcttgtgaggtgatgattgcccccacttacaaacatattgttagaccatcacctatccgatgt |
13081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 11034 - 10941
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||| | |||| | |||||||||||||| | || ||||| |||||| ||||||||||| |
|
|
| T |
11034 |
ctcatccttacaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca |
10941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 14700 - 14607
Alignment:
| Q |
1 |
ctcatccttacaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||| | |||| | |||||||||||||| | || ||||| |||||| ||||||||||| |
|
|
| T |
14700 |
ctcatccttacaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca |
14607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 10788 - 10722
Alignment:
| Q |
15 |
accggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| | ||||| ||||| ||||||| |||||||||||| |
|
|
| T |
10788 |
accggcttgtgaggtgatgattgcccccacttacaaacatattgttagaccatcacctatccgatgt |
10722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 14454 - 14388
Alignment:
| Q |
15 |
accggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgt |
81 |
Q |
| |
|
|||| |||||| ||||| ||||||||||||| | ||||| ||||||||||| | |||||||||||| |
|
|
| T |
14454 |
accgccttgtgaggtgatgattgcccccacttacaaacatattgtcagaccgtcacctatccgatgt |
14388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 36 - 93
Target Start/End: Complemental strand, 429898 - 429841
Alignment:
| Q |
36 |
tgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
429898 |
tgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaac |
429841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0481
Description:
Target: scaffold0481; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 3504 - 3588
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||| ||||||| ||||||| || ||||| |||||||| ||||||||||| |
|
|
| T |
3504 |
acaaaaccggcttgtgaggtgaagattgtccccacttataaacaaattgtcatgtcaactcctaaccgatgtgggactcttaaca |
3588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 81893 - 81809
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
||||||||| ||||| ||||| |||| ||||||| ||||||| |||||||| |||||| || ||||||||| ||||||||||| |
|
|
| T |
81893 |
acaaaaccgacttgtaaggtgaaaattgtccccacttataaacatattgtcaggccatgttctgtccgatgtgggactcttaaca |
81809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 82108 - 82043
Alignment:
| Q |
29 |
tgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||| |||||| | ||| |||||||||||| ||||||| | || |||||| ||||||||||| |
|
|
| T |
82108 |
tgaggatttcccccatttatatacacattgtcaggccatgtcatgtctgatgtgggactcttaaca |
82043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 12698 - 12615
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaac |
93 |
Q |
| |
|
|||||| || |||||| |||||||||||||||||| ||||| ||||||||| ||||| ||||||||| || |||||||||| |
|
|
| T |
12698 |
acaaaatcgacttgtgaggtgaggattgcccccacatataaatacattgtcaaaccatcacctatccgacatgggactcttaac |
12615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 121604 - 121520
Alignment:
| Q |
10 |
acaaaaccggcttgtggggtgaggattgcccccactcataaacacattgtcagaccatgtcctatccgatgtgagactcttaaca |
94 |
Q |
| |
|
|||||||||||||||| | |||||| ||||||||| | ||||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
121604 |
acaaaaccggcttgtgatgggaggatggcccccacttacaaacacattgtcatgtcatcacctatccgatgtaggactcttaaca |
121520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 56
Target Start/End: Complemental strand, 67327 - 67283
Alignment:
| Q |
12 |
aaaaccggcttgtggggtgaggattgcccccactcataaacacat |
56 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
67327 |
aaaaccagcttgtgaggtgatgattgcccccacttataaacacat |
67283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University