View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_high_95 (Length: 272)

Name: NF15163_high_95
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_high_95
NF15163_high_95
[»] chr3 (1 HSPs)
chr3 (177-257)||(382443-382530)
[»] chr5 (1 HSPs)
chr5 (180-237)||(36206251-36206308)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 177 - 257
Target Start/End: Original strand, 382443 - 382530
Alignment:
177 cacccccaaattattgattccccactattcccatcatgtattctctctct-------aaccttcaatcctaatcttaagcttattatt 257  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |       |||||||||||||||||||||||||||||||    
382443 cacccccaaattattgattccccactattcccatcatgtattctctctttaaccttcaaccttcaatcctaatcttaagcttattatt 382530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 180 - 237
Target Start/End: Original strand, 36206251 - 36206308
Alignment:
180 ccccaaattattgattccccactattcccatcatgtattctctctctaaccttcaatc 237  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
36206251 ccccaaattattgattccccacgattcccatcatgtattctctctctaaccttcaatc 36206308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University