View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_high_95 (Length: 272)
Name: NF15163_high_95
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_high_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 177 - 257
Target Start/End: Original strand, 382443 - 382530
Alignment:
| Q |
177 |
cacccccaaattattgattccccactattcccatcatgtattctctctct-------aaccttcaatcctaatcttaagcttattatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
382443 |
cacccccaaattattgattccccactattcccatcatgtattctctctttaaccttcaaccttcaatcctaatcttaagcttattatt |
382530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 180 - 237
Target Start/End: Original strand, 36206251 - 36206308
Alignment:
| Q |
180 |
ccccaaattattgattccccactattcccatcatgtattctctctctaaccttcaatc |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36206251 |
ccccaaattattgattccccacgattcccatcatgtattctctctctaaccttcaatc |
36206308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University