View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_103 (Length: 265)
Name: NF15163_low_103
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_103 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 26577057 - 26577307
Alignment:
| Q |
11 |
ttatactccaacactaatgtctttaatgttatttccaaaaaatgggatatcttattgtatattatccataatgtattttggtggtgcttttatccatatt |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26577057 |
ttatactccaacactcatgtctttaatgttatttccaaaaaatgggatatcttatggtatattatccataatgtattttggtggtgcttttatccatatt |
26577156 |
T |
 |
| Q |
111 |
gtaatcacaaagaccaaggtacatgttttagatcaatgtaatgcaatgtaatagattttgattatttgaataattgatgttcgatgtaatgtgtccgttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
26577157 |
gtaatcacaaagaccaaggtacatgttttagatcaatgtaatgcaatgtaatagattttgattatttgaataattgatgttccatgtgatgtgtccgttc |
26577256 |
T |
 |
| Q |
211 |
agtgataagagttttaactttgtaatctcgagagataagtttgaatcagat |
261 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26577257 |
aatgataagagttttaactttgtaatctcgagagataagtttgaaccagat |
26577307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University