View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_109 (Length: 257)
Name: NF15163_low_109
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 52 - 236
Target Start/End: Complemental strand, 28730488 - 28730304
Alignment:
| Q |
52 |
cctttaaagaaaaaataaagagtatgaaatttggagtgaaagtatatgaagaaggaaatgagggaacatattaaaaaggtgaagaagaagcaagagctga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730488 |
cctttaaagaaaaaataaagagtatgaaatttggagtgaaagtatatgaagaaggaaatgagggaacatattaaaaaggtgaagaagaagcaagagctga |
28730389 |
T |
 |
| Q |
152 |
aaaaaccaaggtggagaaaggtgagggaaagtagagcgtcgttgagatagatgaagtttctatggcgctcagttacagagtctct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730388 |
aaaaaccaaggtggagaaaggtgagggaaagtagagcgtcgttgaggtagatgaagtttctatggcgctcagttacagagtctct |
28730304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University