View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_111 (Length: 253)
Name: NF15163_low_111
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_111 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 39499745 - 39499701
Alignment:
| Q |
21 |
caggctacatacattattacacctacagcccatatatagaataat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39499745 |
caggctacatacattattacacctacagcccatatatagaataat |
39499701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 39445639 - 39445593
Alignment:
| Q |
165 |
catgttttagttaattggctttgtttcattgtttgactatgtatatt |
211 |
Q |
| |
|
|||||||| ||| ||||||||||||||| ||||||||||||| |||| |
|
|
| T |
39445639 |
catgttttggtttattggctttgtttcaatgtttgactatgtgtatt |
39445593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University