View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_low_115 (Length: 248)

Name: NF15163_low_115
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_low_115
NF15163_low_115
[»] chr3 (1 HSPs)
chr3 (16-238)||(1289460-1289682)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 1289682 - 1289460
Alignment:
16 cttgtggtgagattaggtgaagagattgtttatggtgcagcttctggcaataatggaccaggggtatgtcatgagaagtttagaaaattaattttatttt 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||    
1289682 cttgtggtgagattaggtgaagagattgtttatggtgcagcttctggcgataatgaaccaggggtatgtcatgagaagtttagaaaattaattttatttt 1289583  T
116 ctggaaatgattatttaggcctgagttcccatccgactattggaaaggctgctgcaaaggtatgccttgtgaattttgaatgatatttttatcttattct 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1289582 ctggaaatgattatttaggcctgagttcccatccgactattggaaaggctgctgcaaaggtatgccttgtgaattttgaatgatatttttatcttattct 1289483  T
216 gaattttaatctacgggcctttg 238  Q
    ||||||||||||||||| |||||    
1289482 gaattttaatctacgggtctttg 1289460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University