View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_115 (Length: 248)
Name: NF15163_low_115
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_115 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 1289682 - 1289460
Alignment:
| Q |
16 |
cttgtggtgagattaggtgaagagattgtttatggtgcagcttctggcaataatggaccaggggtatgtcatgagaagtttagaaaattaattttatttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1289682 |
cttgtggtgagattaggtgaagagattgtttatggtgcagcttctggcgataatgaaccaggggtatgtcatgagaagtttagaaaattaattttatttt |
1289583 |
T |
 |
| Q |
116 |
ctggaaatgattatttaggcctgagttcccatccgactattggaaaggctgctgcaaaggtatgccttgtgaattttgaatgatatttttatcttattct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1289582 |
ctggaaatgattatttaggcctgagttcccatccgactattggaaaggctgctgcaaaggtatgccttgtgaattttgaatgatatttttatcttattct |
1289483 |
T |
 |
| Q |
216 |
gaattttaatctacgggcctttg |
238 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
1289482 |
gaattttaatctacgggtctttg |
1289460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University