View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_low_119 (Length: 247)

Name: NF15163_low_119
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_low_119
NF15163_low_119
[»] chr2 (1 HSPs)
chr2 (15-231)||(14756787-14757003)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 14756787 - 14757003
Alignment:
15 atcaattatacatgtttttgtgggttgttcaggacaaaaatgcgtttatgttcactctggctactcagttgaaacttggcacatggcttagctggttatg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14756787 atcaattatacatgtttttgtgggttgttcaggacaaaaatgcgtttatgttcactctggctactcagttgaaacttggcacatggcttagctggttatg 14756886  T
115 tcatcaatccctcaaagactttgattatgttcaaacttcaaactgttccaacgtgtcattttgaaatacttttttattaggaatgnnnnnnnnnatttac 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||    
14756887 tcatcaatccctcaaagactttgattatgttcaaacttcaaactgttccaacgtgtcattttgaaatacttttttattaggaatgttttttttaatttac 14756986  T
215 acaaactcaatagaatt 231  Q
    |||||||||||||||||    
14756987 acaaactcaatagaatt 14757003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University