View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_126 (Length: 238)
Name: NF15163_low_126
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_126 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 49070566 - 49070687
Alignment:
| Q |
100 |
tctttggtaaatttggaaatgtggctagtgtgagggtgttgcaagatttgaatcagggg-gaaaaaagccgtgtctatgcctttgtttcttatctctctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49070566 |
tctttggtaaatttggaaatgtggctagtgtgagggtgttgcaagatttgaatcaggggaaaaaaaagccgtgtctatgcctttgtctcttatctctctc |
49070665 |
T |
|
| Q |
199 |
aaagagaacgtgacgcctctat |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49070666 |
aaagagaacgtgacgcctctat |
49070687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 49070514 - 49070569
Alignment:
| Q |
10 |
tgagatgaagaacaatatactatgaaggtcctcataaggtgtatgttgggaatctt |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49070514 |
tgagaagaagaacaatatactatgaaggtcctcataaggtgtatgttgggaatctt |
49070569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University