View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_128 (Length: 237)
Name: NF15163_low_128
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_128 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 221
Target Start/End: Complemental strand, 43439447 - 43439249
Alignment:
| Q |
22 |
atttaaagccaaaacagcactcctacttaaatgtttaccaccccaaaacagggttcaacaaaggccatactctgttagatgaacactgaagctgtaatgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439447 |
atttaaagccaaaacagcactcctacttaaatgtttaccaccccaaaacagggttcaacaaaggccatactctgttagatgaacactgaagctgtaatgg |
43439348 |
T |
 |
| Q |
122 |
gaaaacactnnnnnnnnnnnttgctattggtgatgaaattactggcttacacgaggttttctgcaccatgcaaaaaacaaacctgcctaaaagtctgatc |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439347 |
gaaaacact-aaaaaaaaaattgctattggtgatgaaattactggcttacacaaggttttctgcaccatgcaaaaaacaaacctgcctaaaagtctgatc |
43439249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 221
Target Start/End: Complemental strand, 43423771 - 43423703
Alignment:
| Q |
153 |
gatgaaattactggcttacacgaggttttctgcaccatgcaaaaaacaaacctgcctaaaagtctgatc |
221 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||| |||||||| ||||| |||||||||| |||||| |
|
|
| T |
43423771 |
gatgaaattactggttcagacgaggttttctgcacagtgcaaaaaccaaacatgcctaaaagcctgatc |
43423703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University