View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_129 (Length: 234)
Name: NF15163_low_129
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_129 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 34113489 - 34113304
Alignment:
| Q |
16 |
aagaaggtaaaaggaaagtggaagggtgattatggtaagaaacaacaatttagagatggatgaaagactcattatatgagcaatcttcatcaattcagag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34113489 |
aagaaggtaaaaggaaagtggaagggtgattatggtaagaaacaacaatttagagatggatgaaagactcattat--gagcaatcttcatcaattcagag |
34113392 |
T |
 |
| Q |
116 |
atgagaaattagtaattcaagaggtggctcaaattcaggaagaggaagaggaaagaaggacaagagtaacattcaatgttataattat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34113391 |
atgagaaattagtaattcaagaggtggctcaaattcaggaagaggaagaggaaagaaggacaagagtaacattcaatgttataattat |
34113304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University