View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_134 (Length: 227)
Name: NF15163_low_134
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_134 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 216
Target Start/End: Original strand, 23985348 - 23985543
Alignment:
| Q |
21 |
acatgcaaacatttgtattgcgatagaaaatatagacaaatgcatatgttgcgacggtaagttgtggaccgcaatttagaactatgatagtagtaatata |
120 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
23985348 |
acatgcaaacatttggattgagatagaaaatatagacaaatgcatacgttgcgacggtaagttgtgaaccgcaatttaaaaccatgatagtagtaatata |
23985447 |
T |
|
| Q |
121 |
atagtgatttagaagaccatgaagttcatgtcaaatcctagagttcaactggcttaattagcttagaaatactttcatcccatcgtttcatctcac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
23985448 |
atagtgatttagaagaccatgaagttcatgtcaaatcctagagttcaactggcttaattagcttagaaaaactttcatcccatcgtttcatgtcac |
23985543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University