View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15163_low_135 (Length: 225)

Name: NF15163_low_135
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15163_low_135
NF15163_low_135
[»] chr4 (1 HSPs)
chr4 (5-113)||(39292097-39292209)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 39292097 - 39292209
Alignment:
5 catcatatacctgttttacaacatcaatcgtgtatgtcatta----attaattaatacatctttatgtgtaaactttcaagatttgagtaattgagattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||    
39292097 catcatatacctgttttacaacatcaatcgtgtatgtcattaattaattaattaatacatctttatgtgtaaactttgaagatatgagtaattgagattc 39292196  T
101 atttaaaacatta 113  Q
    |||||||||||||    
39292197 atttaaaacatta 39292209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University