View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_139 (Length: 202)
Name: NF15163_low_139
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_139 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 9376406 - 9376221
Alignment:
| Q |
1 |
gaaattgaattcgaacttttccacatttttcagtgcatggatttttggatgttactggttctgttaatagaagaaagaacatagttagtagaaaggcgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9376406 |
gaaattgaattcgaacttttccacatttttcagtgcatggatttttggatgttactggttctgttaatagaagaaagaacatagttagtagaaaggcgaa |
9376307 |
T |
 |
| Q |
101 |
attgtgaaaattggccannnnnnngtatgattttgcaggtttaggtttaggttgttgttatagtttgagtatgaggaaccttgttt |
186 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9376306 |
attgtgaaaattggccatttttttgtatgattttgcaggtttaggtttaggttgttgttatagtttgagtatgaggaaccttgttt |
9376221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 9237714 - 9237772
Alignment:
| Q |
18 |
tttccacatttttcagtgcatggatttttggatgttactggttctgttaatagaagaaa |
76 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||| || ||||| |
|
|
| T |
9237714 |
tttccacatttttcagtgcattgatttttggatgttactggttttgttaacaggagaaa |
9237772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University