View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_21 (Length: 499)
Name: NF15163_low_21
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 231 - 481
Target Start/End: Original strand, 35517538 - 35517776
Alignment:
| Q |
231 |
tcaagagaaactataaactagtaaaagaagcttgttatcgaccacatttttaaacaaacttataactagctggtcaaataagctataatctaactttttg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
35517538 |
tcaagagaaactataaactagtaaaagaagcttgttaccgaccacatttt-aaacaaacttataactagctagtcaaataagctataatctaacttattg |
35517636 |
T |
|
| Q |
331 |
ctagtatgaaatgtattcttatacttaaataacaattaatgcattataacctgga-aatannnnnnngaccaaattaatactttaccctagaaatcgagt |
429 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
35517637 |
ctagtatgaaatgtatccttataattaaatgacaattaatgcattataccctggattttttttttttgaccaaattaatactttaccctagaaatcgagt |
35517736 |
T |
|
| Q |
430 |
attccannnnnnnnnnctacccacatcatatgagcaacgtatatactatctt |
481 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35517737 |
att------------tctacccacatcatatgaccaacgtatatactatctt |
35517776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University