View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_28 (Length: 452)
Name: NF15163_low_28
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 154 - 435
Target Start/End: Original strand, 37218922 - 37219203
Alignment:
| Q |
154 |
acttttaatgcatggatgtctgcgattccaaatcaacgacagacaaatattttaagtaaaagtttttgcaagaatatacaaacctcttcaacaattttat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218922 |
acttttaatgcatggatgtctgcgattccaaatcaacgacagacaaatattttaagtaaaagtttttgcaagaatatacaaacctcttcaacaattttat |
37219021 |
T |
 |
| Q |
254 |
agcacttggagttgcacccttgaaattgtggctgatatgattctgtggcattggtcataaaaggagtttcatccctgaaatttgacagatgaaactcaag |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219022 |
agcacttggagttgcacccttgaaattgtggctgatatgattctgtggcattggtcataaaaggagtttcatccctgaaatttgacagatgaaactcaag |
37219121 |
T |
 |
| Q |
354 |
tcataaatttgacataattaaattttaatatcttttgacaaatggtattgaatctacttacgtgtttgttaatgttggagaa |
435 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219122 |
tcataaatttgacataattaaattttaatttcttttgacaaatggtattgaatctacttacgtgtttgttaatgttggagaa |
37219203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 13 - 58
Target Start/End: Original strand, 37218744 - 37218789
Alignment:
| Q |
13 |
atattatggtagttatctatctcatttcctcttcttccaggcaact |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218744 |
atattatggtagttatctatctcatttcctcttcttccaggcaact |
37218789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University