View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_39 (Length: 431)
Name: NF15163_low_39
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 13 - 421
Target Start/End: Original strand, 10975758 - 10976166
Alignment:
| Q |
13 |
catcaaatccaaccagcaatatacaaaaacaatatccctggtgtgataaactcaccccaatgtctttgatcaccattcactatcaaatgcggtaaaccat |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10975758 |
catccaatccaaccagcaatatacaaaaacaatatccctggtgtgataaactcaccccaatgtctttgatcaccattcactatcaaatgtggtaaaccat |
10975857 |
T |
 |
| Q |
113 |
cagcaccacacaacaaaccttgctttccatagttatcaaaccttctcttggttttctcaactgttgcttttatggccagcgctggagcactgtccggagc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10975858 |
cagcaccacacaacaaaccttgctttccatagttatcaaaccttctcttggttttctcaactgttgcttttatggccagcgctggagcgctgtccggagc |
10975957 |
T |
 |
| Q |
213 |
gtaaagcttgagggatgattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttagaccggagatgtcggcg |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10975958 |
gtaaagcttgagtgatgattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttaggccggagatgtcggcg |
10976057 |
T |
 |
| Q |
313 |
acagcggggagtggtgatgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttgcttggtttttcttggt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10976058 |
acagcggggagtggtgatgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttggttggtttttcttggt |
10976157 |
T |
 |
| Q |
413 |
ctgtgctgc |
421 |
Q |
| |
|
|||||||| |
|
|
| T |
10976158 |
ttgtgctgc |
10976166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University