View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_61 (Length: 341)
Name: NF15163_low_61
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 23 - 291
Target Start/End: Complemental strand, 28047795 - 28047526
Alignment:
| Q |
23 |
atattctaaggtaggatagactttctaataaattaggaattcttgatgaaactttgcgtagttttgatacat-taatgtttgattgggtttaattttggc |
121 |
Q |
| |
|
||||||||| ||||||||| |||| |||||| ||| ||||||| |||||| ||||||||||||| |||| || ||||||||| ||||| ||| ||||| |
|
|
| T |
28047795 |
atattctaatgtaggatagcctttataataacttacgaattctggatgaagctttgcgtagtttagataaatgtaatgtttggttgggcataagtttggt |
28047696 |
T |
|
| Q |
122 |
tttgcacttctttgtattgctattagtaggttgatcagatggattccattttgggattactgaatactgaattaacaacaataaaaccaaacacagaatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| ||||| |||| | |||||||| |
|
|
| T |
28047695 |
tttgcacttctttgtattgctattagtaggtaaatcagatggattccattttgggattactgaatattgaattcgcaataataataccagaaacagaatt |
28047596 |
T |
|
| Q |
222 |
tgttgtgactgataaatcattgattttagttgttacttttggatcttaccaacttcagattctataagga |
291 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28047595 |
tgatgtgactgatgaatcattgattttagttgttacttttggatcttaccaacttcagattctataagga |
28047526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University