View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_82 (Length: 310)
Name: NF15163_low_82
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 103 - 243
Target Start/End: Complemental strand, 2703385 - 2703245
Alignment:
| Q |
103 |
cacagtttacaccttcaggtttgttttccctttcttccttgttactcctccattcaacctctgttccaaaccttaaggctcattttcgtgctggtttagg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2703385 |
cacagtttacaccttcaggtttgttttccctttcttccttgttactcctccattcaacctctgttccaaacctttaggctcattttcgtgctggtttagg |
2703286 |
T |
 |
| Q |
203 |
gtttatgtgttaattaggtttcattcctcaattgaaataat |
243 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2703285 |
gtttatgtgttaattaagtttcattcctcaattgaaataat |
2703245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 2703524 - 2703426
Alignment:
| Q |
1 |
atccctaaacccctaattcttgtatctctcgtctccttcgaatttgttttctttcttttctaacaaaacagagactcttcacttctcttctcccgccgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2703524 |
atccctaaacccctaattcttgtatctctcgtctccttcgagtttgttttctttcttttctaacaaaacagagactcttcacttctcttctcccgccgc |
2703426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University