View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_86 (Length: 289)
Name: NF15163_low_86
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_86 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 12 - 289
Target Start/End: Complemental strand, 10126032 - 10125755
Alignment:
| Q |
12 |
tcatcatttcgtatattatgctggttggtcttaaaaataaaatcaattctcataaaagaagtcatatctaaaggtcacaatcactaatcccagatacatt |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10126032 |
tcatcatttcgtatattatgcaggttggtcatagaaataaaatcaattctcataaaagaagtcatatctaaaagtcacaatcactaatcccagatacatt |
10125933 |
T |
 |
| Q |
112 |
aggctcaagtaagaaccttatagtttcataccaatggcttcatggtatctggacaaaaggcactgaatattgaatacattaagcttcttttgtaataaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125932 |
aggctcaagtaagaaccttatagtttcataccaatggcttcatggtatctggacaaaaggcactgaatattgaatacattaagcttcttttgtaataaca |
10125833 |
T |
 |
| Q |
212 |
atattgaatacaataacatgtttgctgatgaactacttatatcagattacaattacagaaaagaataaagtgttttgt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125832 |
atattgaatacaataacatgtttgctgatgaactacttatatcagattacaattacagaaaagaataaagtgttttgt |
10125755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 157
Target Start/End: Complemental strand, 10119265 - 10119228
Alignment:
| Q |
120 |
gtaagaaccttatagtttcataccaatggcttcatggt |
157 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
10119265 |
gtaagaaccttatattttcataccaatagcttcatggt |
10119228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University