View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15163_low_98 (Length: 271)
Name: NF15163_low_98
Description: NF15163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15163_low_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 261
Target Start/End: Original strand, 32742007 - 32742260
Alignment:
| Q |
8 |
agtggtggtggtggtggcggtgaggcaaggtgggtttagggatgcggaagtgtcgtaaggggaagctaggattcggaagaagatgattagggtgattaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742007 |
agtggtggtggtggtggcggtgaggcaaggtgggtttagggatgcggaagtgtcgtaaggggaagctaggattcggaagaagatgattagggtgattaga |
32742106 |
T |
|
| Q |
108 |
agaattcttgaatatattgctgattttagtactaatggttcgtgatgatcaaggtttgatttcgtctgaaacattttggattcggatttgatttcgattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742107 |
agaattcttgaatatattgctgattttagtactaatggttcgtgatgatcaaggtttgatttcgtctgaaacattttggattcggatttgatttcgattt |
32742206 |
T |
|
| Q |
208 |
cgtgagaatcatccacttcgctgcagtttcatcttttcaaagcctcaattgatg |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32742207 |
cgtgagaatcatccacttcactgcagtttcatcttttcaaagcctcaattgatg |
32742260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University