View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15164_high_4 (Length: 236)
Name: NF15164_high_4
Description: NF15164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15164_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 51937892 - 51937687
Alignment:
| Q |
14 |
ataatacttaagagtaacaaaataacaatcattttgtaaaatgaaacacaaaatcctaaacaaacagaaccggaagttgcaactacgcaattgagaaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937892 |
ataatacttaagagtaacaaaacaacaatcattttgtaaaatgaaacacaaaatcctaaacaaacagaaccggaagttgcaactacgcaattgagaaaaa |
51937793 |
T |
 |
| Q |
114 |
atttgctactagcatcatttaaaataaatctgacaagttgcagaggtctttgggaacgacagtaatttcgcttttcctcaggattcatggaagacagact |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||| | ||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51937792 |
gtttgctcctagcatcatttaaaataaatctgacaagttgcagagatcttt-gtaacgacaataatttcgcttttcctcaagattcatggaagacagact |
51937694 |
T |
 |
| Q |
214 |
ttctatt |
220 |
Q |
| |
|
||||||| |
|
|
| T |
51937693 |
ttctatt |
51937687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University