View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15164_low_4 (Length: 239)
Name: NF15164_low_4
Description: NF15164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15164_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 51903010 - 51902799
Alignment:
| Q |
17 |
ataacatttcatttttgaatgcatagaaaaacatcataactgttttctacaattttttcatattcttgaaacattgaattatgttattctcatt-ttttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51903010 |
ataacatttcatttttgaatgcatagaaaaacatcataactgttttctacaattttttcatattcttgaaacattgaattatgttattctcatttttttc |
51902911 |
T |
 |
| Q |
116 |
aatatcaatagatacatatgctgttgatgtcgaaaaaatgtgtcagcaaaacatcatacaagtaattaaataatcatttaatcattcatctcttattcaa |
215 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||| || ||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
51902910 |
aacatcaatagatacatacgctgttgatgtcgaaaaaatgtgtcaacaaaacatcatataattaaccaaacaattatttaatcattcatctcttattcaa |
51902811 |
T |
 |
| Q |
216 |
tttttcatctca |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51902810 |
tttttcatctca |
51902799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University