View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15164_low_5 (Length: 239)

Name: NF15164_low_5
Description: NF15164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15164_low_5
NF15164_low_5
[»] chr2 (2 HSPs)
chr2 (48-107)||(18126174-18126233)
chr2 (172-227)||(18126054-18126109)


Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 18126233 - 18126174
Alignment:
48 aatccaagccagagaattttcaactataataaggtttgtcattgaggacatttattgcat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18126233 aatccaagccagagaattttcaactataataaggtttgtcattgaggacatttattgcat 18126174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 18126109 - 18126054
Alignment:
172 gataaacatggagaagttaacttccaaaagagaatctttgggtcccttgtcatatt 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18126109 gataaacatggagaagttaacttccaaaagagaatctttgggtcccttgtcatatt 18126054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University