View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15164_low_5 (Length: 239)
Name: NF15164_low_5
Description: NF15164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15164_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 18126233 - 18126174
Alignment:
| Q |
48 |
aatccaagccagagaattttcaactataataaggtttgtcattgaggacatttattgcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18126233 |
aatccaagccagagaattttcaactataataaggtttgtcattgaggacatttattgcat |
18126174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 18126109 - 18126054
Alignment:
| Q |
172 |
gataaacatggagaagttaacttccaaaagagaatctttgggtcccttgtcatatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18126109 |
gataaacatggagaagttaacttccaaaagagaatctttgggtcccttgtcatatt |
18126054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University