View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15165_high_11 (Length: 247)
Name: NF15165_high_11
Description: NF15165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15165_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 49736544 - 49736397
Alignment:
| Q |
1 |
ggtagaagaattcccagtaaggttagttagnnnnnnncttcagtttcatattacatttcaattattattgctttgataataattcaattgaatcataaaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49736544 |
ggtagaagaattcctagtaaggttagttagtttttttcttcagtttcatattacatttcaattattattgctttgataataattcaattgaatcataaaa |
49736445 |
T |
|
| Q |
101 |
gatatttagctctgtgaattgtgatatttgaagctctgcaaattgctt |
148 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49736444 |
gatatttagctctgtgaattctgatatttgaagctctgcaaattgctt |
49736397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University