View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15165_low_6 (Length: 336)

Name: NF15165_low_6
Description: NF15165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15165_low_6
NF15165_low_6
[»] chr5 (1 HSPs)
chr5 (222-317)||(29072029-29072124)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 222 - 317
Target Start/End: Original strand, 29072029 - 29072124
Alignment:
222 agaaatatgttatgcatgtacctccatcatagcttgaacccaataacgacgattgattgaattgacaccaatgacagtttttgtggggtgtttaac 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29072029 agaaatatgttatgcatgtacctccatcatagcttgaacccaataacgacgattgattgaattgacaccaatgacagtttttgtggggtgtttaac 29072124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University