View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15165_low_9 (Length: 296)
Name: NF15165_low_9
Description: NF15165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15165_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 12249097 - 12249377
Alignment:
| Q |
1 |
attctatatcaaaattggaacaagtttgaacgtagacatgtttaagccatcatatacaagacaacttctccgaaatttttatgtcaaaattcggagccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12249097 |
attctatatcaaaattggaacaagtttgaacgtagacatgtttaagccatcatatacaagacaacttctccgaaatttttatgtcaaaattcggagccat |
12249196 |
T |
|
| Q |
101 |
ttgcaacacctacatattttccttgttaaatttataattataataatccatggcatgtctataagaatgaaataaaaataatccatggcatgtctcgtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12249197 |
ttgcaacacctacatattttccttgttgaatttataattataataatccatggcatgtctataagaatgaaataaaaataatccatggcatgtctcctta |
12249296 |
T |
|
| Q |
201 |
cctaccagccccaatttatttattgtactacgaatgcaacaagggaaggaaacatcctttaaaaattgccaacattatatt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12249297 |
cctaccagccccaatttatttattgtactacgaatgcaacaagggaaggaaacatcctttaaaaattgccaacattatatt |
12249377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 182 - 259
Target Start/End: Original strand, 12232636 - 12232713
Alignment:
| Q |
182 |
tccatggcatgtctcgttacctaccagccccaatttatttattgtactacgaatgcaacaagggaaggaaacatcctt |
259 |
Q |
| |
|
||||||| |||||| ||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12232636 |
tccatggtctgtctccttacccactagccccaatttatttaatgtactacgaatgcaacaagggaaggaaacatcctt |
12232713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 259
Target Start/End: Original strand, 12241488 - 12241570
Alignment:
| Q |
177 |
aataatccatggcatgtctcgttacctaccagccccaatttatttattgtactacgaatgcaacaagggaaggaaacatcctt |
259 |
Q |
| |
|
||||||||||| | || ||| |||||||| || ||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12241488 |
aataatccatgacctgcctccttacctactagacccaatttatttattgtactatgaatgcaacaatggaaggaaacatcctt |
12241570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 182 - 262
Target Start/End: Original strand, 12227572 - 12227652
Alignment:
| Q |
182 |
tccatggcatgtctcgttacctaccagccccaatttatttattgtactacgaatgcaacaagggaaggaaacatcctttaa |
262 |
Q |
| |
|
||||||| |||||| ||||| || |||||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12227572 |
tccatggtttgtctccttacccactagccccaatttatttaatgtactactaatgcaacaaggggaggaaacatcctttaa |
12227652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 112
Target Start/End: Original strand, 12227386 - 12227422
Alignment:
| Q |
76 |
tttttatgtcaaaattcggagccatttgcaacaccta |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12227386 |
tttttatgtcaaaattcttagccatttgcaacaccta |
12227422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 208 - 259
Target Start/End: Original strand, 39114292 - 39114343
Alignment:
| Q |
208 |
gccccaatttatttattgtactacgaatgcaacaagggaaggaaacatcctt |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39114292 |
gccccaatttatttaatgtactacgaatgcaacaagggaaggaaacatcctt |
39114343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University