View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15166_high_2 (Length: 372)
Name: NF15166_high_2
Description: NF15166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15166_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 29 - 340
Target Start/End: Complemental strand, 8016871 - 8016563
Alignment:
| Q |
29 |
cccatcggcgatcaacaacagccgtccgatccaacaaggtttcagttggaccaacgagattattaacgaaactcaaacaagactgtgcaactcctctacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016871 |
cccatcggcgatcaacaacagccgtccgatccaacaaggtttcagttggaccaacgagattattaacgaaactcaaacaagactgtgcaactcctctacc |
8016772 |
T |
|
| Q |
129 |
tcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtccac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016771 |
tcttcttcaccatgttgctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtccac |
8016672 |
T |
|
| Q |
229 |
actcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattattattgac |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8016671 |
actcttccctccgggtatgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat---tattgac |
8016575 |
T |
|
| Q |
329 |
atgatgatgatg |
340 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8016574 |
atgatgatgatg |
8016563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University